miRBase entry: hsa-mir-128-1

Stem-loop hsa-mir-128-1


Accession
MI0000447
Symbol
HGNC: MIR128-1
Description
Homo sapiens hsa-mir-128-1 precursor miRNA mir-128
Gene
family?
RF00649; mir-128

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR128-1 is a gene that plays a crucial role in the regulation of protein interactions within cells, specifically by targeting the protein Bmi1, which in turn affects the protein cadherin encoded by CDH1 [PMC5320387]. This gene is noteworthy for producing identical mature miR-128-3p sequences as its counterpart, MIR128-2, while also encoding for miR-128-1-5p species that are slightly different from the miR-128-2-5p species encoded by MIR128-2 [PMC5481840].

Literature search
174 open access papers mention hsa-mir-128-1
(983 sentences)

Sequence

181014 reads, 1158 reads per million, 135 experiments
ugagcuguuggauuCGGGGCCGUAGCACUGUCUGAGAgguuuacauuucUCACAGUGAACCGGUCUCUUUuucagcugcuuc
.((((.((((((...(((((((...((((((..(((((((....)))))))))))))...)))))))...)))))).)))).

Structure
u    u      uuC       UAG      CU       u 
 gagc guugga   GGGGCCG   CACUGU  GAGAggu u
 |||| ||||||   |||||||   ||||||  |||||||  
 uucg cgacuu   CUCUGGC   GUGACA  CUcuuua a
c    u      UUU       CAA      --       c 


Annotation confidence High
Do you think this miRNA is real?
Comments
The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2.

Genome context
chr2: 135665397-135665478 [+]

Disease association
hsa-mir-128-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-128-3p

Accession MIMAT0000424
Description Homo sapiens hsa-miR-128-3p mature miRNA
Sequence 50 - UCACAGUGAACCGGUCUCUUU - 70
Evidence experimental
cloned [3], Illumina [4]
Database links
Predicted targets

Mature hsa-miR-128-1-5p

Accession MIMAT0026477
Description Homo sapiens hsa-miR-128-1-5p mature miRNA
Sequence 15 - CGGGGCCGUAGCACUGUCUGAGA - 37
Evidence experimental
Illumina [4]
Database links
Predicted targets

References

  1. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  4. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45