MIR133A1 is a gene that encodes miR-133a1, a mature microRNA in humans. It is located at 18q11.2 [PMC3323546]. miR-133a is mainly expressed in muscles and plays a role in controlling the pathogenesis of insulin resistance [PMC7913585]. MIR133A1, along with MIR133A2, promotes muscle differentiation and expression during myogenesis [PMC5137429]. In glioma samples, MIR133A1 was found to be downregulated [PMC8634738]. It is also expressed during pluripotent stem cell differentiation into the cardiac lineage [PMC6828809]. MIR133A1 and MIR133A2 are involved in promoting pre-cardiac mesoderm while suppressing endodermal and neuroectodermal lineages [PMC6828809]. In the context of familial atrial fibrillation, genetic screening of the MIR133A1 gene was performed [PMC3599331]. Alterations in MIR133A1 were observed in pancreatic ductal adenocarcinoma patients [PMC9599289]. Overexpression of TF ESF1 downregulates miRNA MIR133A1 to upregulate the target gene EGFR in prostate tumors [PMC8840188]. Additionally, 11 genes were found to be common between two top 20 lists, including MIR133A1 [PMC6890825].
a uuu g AA U A gccuc caaugc gcua AGCUGGU AA GG ACCAAAUc u |||||| |||| ||||||| || || |||||||| guuacg cgau UCGACCA UU CC UGGUUUag u a uau G AC C C guaac
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000427 |
Description | Homo sapiens hsa-miR-133a-3p mature miRNA |
Sequence | 53 - UUUGGUCCCCUUCAACCAGCUG - 74 |
Evidence |
experimental
cloned [2], Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026478 |
Description | Homo sapiens hsa-miR-133a-5p mature miRNA |
Sequence | 16 - AGCUGGUAAAAUGGAACCAAAU - 37 |
Evidence |
experimental
Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|