The MIR133A2 gene is one of the top two mutated miRNAs, with a copy number gain in approximately 7% of patients [PMC4967895]. MIR133A2 encodes miR-133a2, which is located on chromosome 20 [PMC3599331]. A variant in MIR133A2, specifically a 79T > C substitution, alters the processing of the miR-133a duplex and increases the relative abundance of miR-133a-5p [PMC3599331]. This variant is located adjacent to the Drosha cleavage site in the stem-loop structure of miR-133a-3p [PMC3599331]. The presence of this variant may modify gene expression profiles in the atrium [PMC3599331'>PMC3599331'>PMC3599331'>PMC3599331]. A haplotype including several variants in MIR133A2 was found in a cohort with atrial fibrillation (AF) probands and controls [PMC3599331]. Additionally, a missense variant in MIR133A2 alters miR-133a duplex processing and strand abundance, resulting in accumulation of miR-133a-5p [PMC3599331]. This variant was found in a patient with AF and other cardiovascular conditions [PMC3599331]. Variations in MIR133A2 have also been associated with stable warfarin dose and insulin resistance [PMC6635724] [PMC7913585]. The relationship between the 79T > C MIR133A2 variant and AF is still uncertain [PMC3599331] .
g a -- uuu g AA U A g cug gg gcca aaugc gcua AGCUGGU AA GG ACCAAAUc a u || |||| ||||| |||| ||||||| || || |||||||| | cc cggu uuacg cgau UCGACCA UU CC UGGUUUag u c g g ag ugu G AC C C g aac
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000427 |
Description | Homo sapiens hsa-miR-133a-3p mature miRNA |
Sequence | 59 - UUUGGUCCCCUUCAACCAGCUG - 80 |
Evidence |
experimental
cloned [2], Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026478 |
Description | Homo sapiens hsa-miR-133a-5p mature miRNA |
Sequence | 22 - AGCUGGUAAAAUGGAACCAAAU - 43 |
Evidence |
experimental
Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|