Stem-loop hsa-mir-133a-2

Accession

MI0000451

Symbol

HGNC: MIR133A2

Description

Homo sapiens hsa-mir-133a-2 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

The MIR133A2 gene is one of the top two mutated miRNAs, with a copy number gain in approximately 7% of patients [PMC4967895]. MIR133A2 encodes miR-133a2, which is located on chromosome 20 [PMC3599331]. A variant in MIR133A2, specifically a 79T > C substitution, alters the processing of the miR-133a duplex and increases the relative abundance of miR-133a-5p [PMC3599331]. This variant is located adjacent to the Drosha cleavage site in the stem-loop structure of miR-133a-3p [PMC3599331]. The presence of this variant may modify gene expression profiles in the atrium [PMC3599331'>PMC3599331'>PMC3599331'>PMC3599331]. A haplotype including several variants in MIR133A2 was found in a cohort with atrial fibrillation (AF) probands and controls [PMC3599331]. Additionally, a missense variant in MIR133A2 alters miR-133a duplex processing and strand abundance, resulting in accumulation of miR-133a-5p [PMC3599331]. This variant was found in a patient with AF and other cardiovascular conditions [PMC3599331]. Variations in MIR133A2 have also been associated with stable warfarin dose and insulin resistance [PMC6635724] [PMC7913585]. The relationship between the 79T > C MIR133A2 variant and AF is still uncertain [PMC3599331] .

Literature search

381 open access papers mention hsa-mir-133a-2
(1828 sentences)

Sequence

29754 reads, 684 reads per million, 120 experiments

gggagccaaaugcuuugcuagAGCUGGUAAAAUGGAACCAAAUcgacuguccaauggaUUUGGUCCCCUUCAACCAGCUGuagcugugcauugauggcgccg
.((.(((((((((...((((.(((((((..((.((.((((((((.(........).)))))))).)).))..))))))).))))...)))))..)))).)).

Structure

g  a    --     uuu    g       AA  U  A        g cug 
 gg gcca  aaugc   gcua AGCUGGU  AA GG ACCAAAUc a   u
 || ||||  |||||   |||| |||||||  || || |||||||| |    
 cc cggu  uuacg   cgau UCGACCA  UU CC UGGUUUag u   c
g  g    ag     ugu    G       AC  C  C        g aac 

Annotation confidence High

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1] later verified in human [2].

Genome context

chr20: 62564912-62565013 [+]

Disease association

hsa-mir-133a-2 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-133a-3p

• Accession: MIMAT0000427
• Description: Homo sapiens hsa-miR-133a-3p mature miRNA
• Sequence: 59 - UUUGGUCCCCUUCAACCAGCUG - 80
• Evidence: experimental ; cloned [2], Illumina [3]

Mature hsa-miR-133a-5p

• Accession: MIMAT0026478
• Description: Homo sapiens hsa-miR-133a-5p mature miRNA
• Sequence: 22 - AGCUGGUAAAAUGGAACCAAAU - 43
• Evidence: experimental ; Illumina [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


3. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45