MIR135A1 is a member of the miR135a family in mice [PMC3861205]. It is located in the human chromosome 3p21.2 region [PMC10101835]. This region contains not only well-known protein-coding tumor suppressor genes (TSGs) like TP53 but also six microRNAs, including MIR135A1 [PMC5001246]. MIR135A1 is under regulatory control of NIR17 and MIR135B [PMC3948699]. The promoter region of the MIR135A1 gene does not show differential methylation status between different clusters [PMC9885701]. The CNVs (copy number variations) of the genes encoding miR-135a-5p transcript, including MIR135A1, do not show significantly different frequencies of alteration between clusters [PMC9885701]. Promoter sequences of the MIR135A1 gene were retrieved from UCSC using R/Bioconductor packages BSgenome.Hsapiens.UCSC.hg19 [PMC9885701]. Transcription factor binding sites were searched in the promoter sequences of both MIR135A1 and MIR135A2 genes to understand their transcriptional regulation [PMC9885701]. MiR-135a is encoded by two genes: MIR135A1 on human chromosome 3 and MIR135A2 on human chromosome 12 [PMC9160269]. MiR-135b is encoded by the MIR135B gene located on human chromosome 1q32.1 [PMC7476096]. Frequent deletion or amplification of the loci for miR-135, including MIR135A1, MIR135A2, and MIR135B, may be associated with dysregulation of certain members of this family and poor prognosis in primary breast cancers [PMC9486161].
agg u u UU uucua ccucgcugu c cUAUGGCUUU AUUCCUAUGUGA c ||||||||| | |||||||||| |||||||||||| u ggggcggca G GGUGCCGAGG UAGGGAUAUacu g aca c C -U cacuc
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000428 |
Description | Homo sapiens hsa-miR-135a-5p mature miRNA |
Sequence | 17 - UAUGGCUUUUUAUUCCUAUGUGA - 39 |
Evidence |
experimental
cloned [2-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004595 |
Description | Homo sapiens hsa-miR-135a-3p mature miRNA |
Sequence | 56 - UAUAGGGAUUGGAGCCGUGGCG - 77 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|