Stem-loop hsa-mir-135a-1

Accession

MI0000452

Symbol

HGNC: MIR135A1

Description

Homo sapiens hsa-mir-135a-1 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR135A1 is a microRNA gene located on human chromosome 3p21.2, which, along with MIR135A2 on chromosome 12q23.1, encodes for the miR-135a family members in mice [PMC3861205][PMC10101835[PMC10101835]. These microRNAs, including MIR135A1, are situated in genomic regions with frequent copy number losses (CNLs) in tumor suppressor genes (TSGs), indicating their potential role in cancer [PMC5001246]. MIR135A1 is also part of a regulatory network involving the WAC gene and other microRNAs [PMC3948699]. Despite their importance, no significant differences were observed in the methylation status of the promoter regions of MIR135A1 and MIR135A2 between two analyzed clusters of samples [PMC9885701]. Additionally, copy number variations (CNVs) for these genes did not show significant differences between these clusters either [PMC9885701]. The promoter sequences for these genes were analyzed to understand transcriptional regulation differences that might explain variations in miR-135a-5p expression between clusters [PMC9885701]. Frequent deletion of the MIR135A1 locus has been associated with poor prognosis in primary breast cancers, suggesting its importance as a potential prognostic marker or therapeutic target [PMC9486161].

Literature search

153 open access papers mention hsa-mir-135a-1
(512 sentences)

Sequence

7503 reads, 227 reads per million, 117 experiments

aggccucgcuguucucUAUGGCUUUUUAUUCCUAUGUGAuucuacugcucacucaUAUAGGGAUUGGAGCCGUGGCGcacggcggggaca
...(((((((((.(.((((((((((..((((((((((((.............)))))))))))).)))))))))).).)))))))))...

Structure

agg         u u          UU            uucua 
   ccucgcugu c cUAUGGCUUU  AUUCCUAUGUGA     c
   ||||||||| | ||||||||||  ||||||||||||     u
   ggggcggca G GGUGCCGAGG  UAGGGAUAUacu     g
aca         c C          -U            cacuc 

Annotation confidence High

Comments

miR-135a was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2].

Genome context

chr3: 52294219-52294308 [-]

Disease association

hsa-mir-135a-1 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-135a-5p

• Accession: MIMAT0000428
• Description: Homo sapiens hsa-miR-135a-5p mature miRNA
• Sequence: 17 - UAUGGCUUUUUAUUCCUAUGUGA - 39
• Evidence: experimental ; cloned [2-3]

Mature hsa-miR-135a-3p

• Accession: MIMAT0004595
• Description: Homo sapiens hsa-miR-135a-3p mature miRNA
• Sequence: 56 - UAUAGGGAUUGGAGCCGUGGCG - 77
• Evidence: experimental ; cloned [3]

References

1. PubMed ID: 15183728
   Human embryonic stem cells express a unique set of microRNAs
   "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
   "Dev Biol (2004) 270:488-498


2. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


3. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739