miRBase entry: hsa-mir-135a-2

Stem-loop hsa-mir-135a-2


Accession
MI0000453
Symbol
HGNC: MIR135A2
Description
Homo sapiens hsa-mir-135a-2 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR135A2 is a microRNA implicated in the modulation of midbrain development through the repression of the gene Lmx1b [PMC3861205]. Research involving luciferase assays in HEK293 cells demonstrated that MIR135A2 could repress a reporter construct containing a segment of the Lmx1b 3′ untranslated region (UTR) [PMC3861205]. However, this repression did not occur when mutations were introduced into the MIR135A2 binding sites within the Lmx1b 3′UTR, underscoring the specificity of MIR135A2's interaction with its target [PMC3861205]. These findings suggest that MIR135A2 has a functional role in midbrain development by directly targeting and regulating Lmx1b expression [PMC3861205].

Literature search
151 open access papers mention hsa-mir-135a-2
(509 sentences)

Sequence

7823 reads, 32 reads per million, 92 experiments
agauaaauucacucuagugcuuUAUGGCUUUUUAUUCCUAUGUGAuaguaauaaagucucAUGUAGGGAUGGAAGCCAUGAAauacauugugaaaaauca
.(((...(((((....(((.((((((((((((.((((((((((((.(.(.....).).)))))))))))))))))))))))).)))...)))))..))).

Structure
a   aaa     ucua   c            U            u g a 
 gau   uucac    gug uuUAUGGCUUUU AUUCCUAUGUGA a u a
 |||   |||||    ||| |||||||||||| |||||||||||| | | u
 cua   aagug    cau AAGUACCGAAGG UAGGGAUGUAcu u a a
a   -aa     -uua   a            -            c g a 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
miR-135a was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2].

Genome context
chr12: 97563812-97563911 [+]

Disease association
hsa-mir-135a-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-135a-5p

Accession MIMAT0000428
Description Homo sapiens hsa-miR-135a-5p mature miRNA
Sequence 23 - UAUGGCUUUUUAUUCCUAUGUGA - 45
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-135a-2-3p

Accession MIMAT0037309
Description Homo sapiens hsa-miR-135a-2-3p mature miRNA
Sequence 61 - AUGUAGGGAUGGAAGCCAUGAA - 82
Evidence not_experimental

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739