MIR135A2 is a microRNA implicated in the modulation of midbrain development through the repression of the gene Lmx1b [PMC3861205]. Research involving luciferase assays in HEK293 cells demonstrated that MIR135A2 could repress a reporter construct containing a segment of the Lmx1b 3′ untranslated region (UTR) [PMC3861205]. However, this repression did not occur when mutations were introduced into the MIR135A2 binding sites within the Lmx1b 3′UTR, underscoring the specificity of MIR135A2's interaction with its target [PMC3861205]. These findings suggest that MIR135A2 has a functional role in midbrain development by directly targeting and regulating Lmx1b expression [PMC3861205].
a aaa ucua c U u g a gau uucac gug uuUAUGGCUUUU AUUCCUAUGUGA a u a ||| ||||| ||| |||||||||||| |||||||||||| | | u cua aagug cau AAGUACCGAAGG UAGGGAUGUAcu u a a a -aa -uua a - c g a
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000428 |
| Description | Homo sapiens hsa-miR-135a-5p mature miRNA |
| Sequence | 23 - UAUGGCUUUUUAUUCCUAUGUGA - 45 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0037309 |
| Description | Homo sapiens hsa-miR-135a-2-3p mature miRNA |
| Sequence | 61 - AUGUAGGGAUGGAAGCCAUGAA - 82 |
| Evidence | not_experimental |
|