MIR135A2 is a microRNA that has been investigated for its role in modulating midbrain development [PMC3861205]. In a study, the researchers aimed to determine if MIR135A2 is capable of repressing Lmx1b, a gene involved in midbrain development [PMC3861205]. To test this hypothesis, they conducted a luciferase assay in HEK293 cells [PMC3861205]. The results showed that MIR135A2 was able to repress a construct containing a fragment of the Lmx1b 3′UTR [PMC3861205'>PMC3861205'>PMC3861205'>PMC3861205]. However, when constructs with mutations within the evolutionarily conserved MIR135A2 binding site of the Lmx1b 3′UTR were used, repression was not observed [PMC3861205]. These findings suggest that MIR135A2 specifically targets and represses Lmx1b through its binding site within the 3′UTR of the gene [PMC3861205]. This study provides evidence for the role of MIR135A2 in modulating midbrain development by regulating Lmx1b expression [PMC3861205]. Further research is needed to fully understand the mechanisms and implications of this regulatory interaction [PMC3861205].
a aaa ucua c U u g a gau uucac gug uuUAUGGCUUUU AUUCCUAUGUGA a u a ||| ||||| ||| |||||||||||| |||||||||||| | | u cua aagug cau AAGUACCGAAGG UAGGGAUGUAcu u a a a -aa -uua a - c g a
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000428 |
Description | Homo sapiens hsa-miR-135a-5p mature miRNA |
Sequence | 23 - UAUGGCUUUUUAUUCCUAUGUGA - 45 |
Evidence |
experimental
cloned [2-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0037309 |
Description | Homo sapiens hsa-miR-135a-2-3p mature miRNA |
Sequence | 61 - AUGUAGGGAUGGAAGCCAUGAA - 82 |
Evidence | not_experimental |
|