WARNING: This summary was generated by AI. MIR137 is a microRNA implicated in various biological processes and has been associated with neurological functions and disorders [PMC7237267]. In neurons with a conditional knockout (cKO) of MIR137, treatment with VU0240551 has been shown to adjust the maximum peak outward potassium amplitude to levels comparable to wild-type (WT) neurons, which may suggest a potential compensatory mechanism or therapeutic target [PMC7237267]. However, while the methylation status of MIR137 has been studied in the context of cancer, the specific link to the progression of non-small-cell lung cancer requires further clarification, as the evidence does not conclusively attribute this association to MIR137 alone without considering other factors [PMC4626561].
g u u -- ug G G - g g cc cug acucucuucgg ACG GUAUUCUUGGGUG AUAAUa cg a | || ||| ||||||||||| ||| ||||||||||||| |||||| || u c gg gac ugagaggagcu UGC CAUAAGAAUUCGU UAUUgu gc u a - c ca GA G - u a
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0037310 |
| Description | Homo sapiens hsa-miR-137-5p mature miRNA |
| Sequence | 23 - ACGGGUAUUCUUGGGUGGAUAAU - 45 |
| Evidence | not_experimental |
| Accession | MIMAT0000429 |
| Description | Homo sapiens hsa-miR-137-3p mature miRNA |
| Sequence | 59 - UUAUUGCUUAAGAAUACGCGUAG - 81 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|