MIR142 is a microRNA implicated in various biological processes and diseases, including leukemogenesis and intestinal inflammation. In Sgca-/- mice, a vector regulated by MIR142.3p showed decreased transgene expression over time [PMC4283385]. MIR142−/− mice were created by excising the MIR142 region in mouse embryonic stem cells, facilitating the study of its functions [PMC6910913]. Research on the synergy between MIR142 and IDH2R140Q mutations in leukemogenesis highlighted the importance of MIR142's presence or absence [PMC7656267]. An analysis of 672 samples across different myeloproliferative neoplasms (MPNs) included examining mutations in MIR142 [PMC9240003]. Additionally, MIR142 has been identified as an autophagy-regulating molecule that targets ATG16L1, linking it to Crohn's disease [PMC6351131]. In the context of chronic alcohol consumption, it has been found that sperm microRNA composition is altered, including changes in levels of MIR142; however, these changes are not associated with corticosterone levels but may be related to epididymal trafficking [PMC9886817]. Furthermore, it has been established that among microRNAs, both MIR24 and MIR142 are significant due to their ability to target over 1,000 genes each [PMC7287171]. Lastly, vectors containing GFP controlled by a promoter hybrid including sequences of MIR142 were purified for experimental use [PMC7184633].
 
                            g g c A Uaa ag a acagugca uca cCAUAAAGUAG AAGCACUAC c c c |||||||| ||| ||||||||||| ||||||||| | | ugucaugu agu GGUAUUUCAUC UUUGUGAUG g g u g g A C -Ug ga g
| Name | Accession | Chromosome | Start | End | Strand | Confidence | 
|---|
| Disease | Description | Category | PubMed ID | 
|---|
| Accession | MIMAT0000433 | 
| Description | Homo sapiens hsa-miR-142-5p mature miRNA | 
| Sequence | 16 - CAUAAAGUAGAAAGCACUACU - 36 | 
| Evidence | experimental cloned [3-4] | 
| Database links |       | 
| Predicted targets |       | 
| Accession | MIMAT0000434 | 
| Description | Homo sapiens hsa-miR-142-3p mature miRNA | 
| Sequence | 52 - UGUAGUGUUUCCUACUUUAUGGA - 74 | 
| Evidence | experimental cloned [2-4] | 
| Database links |       | 
| Predicted targets |       | 
| 
 |