miRBase entry: hsa-mir-142

Stem-loop hsa-mir-142


Accession
MI0000458
Symbol
HGNC: MIR142
Description
Homo sapiens hsa-mir-142 precursor miRNA mir-142
Gene
family?
RF01896; mir-142

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR142 is a microRNA implicated in various biological processes and diseases, including leukemogenesis and intestinal inflammation. In Sgca-/- mice, a vector regulated by MIR142.3p showed decreased transgene expression over time [PMC4283385]. MIR142−/− mice were created by excising the MIR142 region in mouse embryonic stem cells, facilitating the study of its functions [PMC6910913]. Research on the synergy between MIR142 and IDH2R140Q mutations in leukemogenesis highlighted the importance of MIR142's presence or absence [PMC7656267]. An analysis of 672 samples across different myeloproliferative neoplasms (MPNs) included examining mutations in MIR142 [PMC9240003]. Additionally, MIR142 has been identified as an autophagy-regulating molecule that targets ATG16L1, linking it to Crohn's disease [PMC6351131]. In the context of chronic alcohol consumption, it has been found that sperm microRNA composition is altered, including changes in levels of MIR142; however, these changes are not associated with corticosterone levels but may be related to epididymal trafficking [PMC9886817]. Furthermore, it has been established that among microRNAs, both MIR24 and MIR142 are significant due to their ability to target over 1,000 genes each [PMC7287171]. Lastly, vectors containing GFP controlled by a promoter hybrid including sequences of MIR142 were purified for experimental use [PMC7184633].

Literature search
284 open access papers mention hsa-mir-142
(1956 sentences)

Sequence

381593 reads, 2448 reads per million, 132 experiments
gacagugcagucaccCAUAAAGUAGAAAGCACUACUaacagcacuggagggUGUAGUGUUUCCUACUUUAUGGAugaguguacugug
.((((((((.(((.(((((((((((.(((((((((...(..(....)..)..))))))))).))))))))))).))).)))))))).

Structure
g        g   c           A         Uaa ag a 
 acagugca uca cCAUAAAGUAG AAGCACUAC   c  c c
 |||||||| ||| ||||||||||| |||||||||   |  |  
 ugucaugu agu GGUAUUUCAUC UUUGUGAUG   g  g u
g        g   A           C         -Ug ga g 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Michael et al. verified the expression of a sequence from the 3' arm of this stem-loop (named miR-142-3p here) [2], and both miR-142-5p (from the 5' arm) and miR-142-3p ware later detected in human HL-60 leukemia cells [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr17: 58331232-58331318 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-142
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-142 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-142-5p

Accession MIMAT0000433
Description Homo sapiens hsa-miR-142-5p mature miRNA
Sequence 16 - CAUAAAGUAGAAAGCACUACU - 36
Evidence experimental
cloned [3-4]
Database links
Predicted targets

Mature hsa-miR-142-3p

Accession MIMAT0000434
Description Homo sapiens hsa-miR-142-3p mature miRNA
Sequence 52 - UGUAGUGUUUCCUACUUUAUGGA - 74
Evidence experimental
cloned [2-4]
Database links
Predicted targets

References

  1. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  2. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  3. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  4. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739