WARNING: This summary was generated by AI. MIR144 is a microRNA that plays a regulatory role in various cellular processes, influencing adipocyte differentiation and energy metabolism by inducing brown/beige-like characteristics in differentiated adipocytes through the downregulation of the MAP3K8/ERK1/2/PPARγ axes [PMC9779381]. It has been found that overexpression of MIR144 significantly increases the expression of human GRβ without affecting GRα, suggesting a selective effect on glucocorticoid receptor subtypes [PMC5053652]. Additionally, MIR144 has been implicated in disrupting the binding of miR153, miR27a, and miR142-5p to the human Nrf2 3′ UTR, thereby identifying Nrf2 as a direct target and potentially influencing oxidative stress responses [PMC3517581]. The microRNA also reduces mRNA levels of c-Met and ADAM10, which are key molecules in cell growth and neurodevelopment [PMC7352235]. The expression of MIR144 is regulated by components of the AP1 complex, linking it to transcription factors associated with cell proliferation and apoptosis [PMC7123062]. Moreover, increased levels of MIR144 have been reported in colorectal cancer tissues, suggesting a role in cancer biology [PMC4599290].
-u - u G A -A gc ggg gccc ggcugG AUAUCAUC UAUACUGUA Guuu g ||| |||| |||||| |||||||| ||||||||| |||| ccc cggg cugaUC UGUAGUAG AUAUGACAU caga a cc a c A - ca gu
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004600 |
| Description | Homo sapiens hsa-miR-144-5p mature miRNA |
| Sequence | 15 - GGAUAUCAUCAUAUACUGUAAG - 36 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000436 |
| Description | Homo sapiens hsa-miR-144-3p mature miRNA |
| Sequence | 52 - UACAGUAUAGAUGAUGUACU - 71 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|