MIR145 is a microRNA that has been found to be involved in various biological processes and diseases. In diabetic nephropathy (DN) patients, MIR145 levels were significantly higher in urinary extracellular vesicles (uEVs) compared to normoalbuminuric patients, and its levels further increased with the development of proteinuria [PMC9603196]. MIR145 is transcribed as a single precursor molecule along with Mir143 and is known to regulate stem cell pluripotency [PMC7956570]. In mice, the loss of Sox2 leads to an increase in MIR145 levels, which subsequently reduces Sox9 protein levels [PMC3865748]. Promoter hypermethylation of MIR145 has been observed in pituitary tumors compared to normal tissue [PMC7281098]. A logistic regression model including miR-7, miR-126, and MIR145 showed promising results in distinguishing non-small cell lung cancer (NSCLC) patients from controls [PMC6463117]. In an experimental study using mice, the injection of MIR145 into tumors resulted in a reduction in tumor volume [PMC5297811]. Additionally, upregulation of MIR145 has been observed in the blood of patients with idiopathic pulmonary arterial hypertension (IPAH) [PMC4357130]. Furthermore, alterations in the expression of MIR145 have been found upon doxorubicin treatment in breast cancer cells [PMC6679136]. The miR-17-92 cluster has also been shown to promote lung progenitor proliferation [PMC4304179]. Finally, MIR145 has potential as a candidate biomarker for breast cancer diagnosis and its oral application along with other tumor suppressor miRs showed promising results for blocking colon cancer tumorigenesis in mice [PMC6786248] [PMC7147085].
c u u c UC U C uagau acc ug ccuca gG CAGU UU CCAGGAAUCCCU g ||| || ||||| || |||| || |||||||||||| c ugg ac ggagu UC GUCA AA GGUCCUUAGGgg u u u u - UU U A uagaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000437 |
Description | Homo sapiens hsa-miR-145-5p mature miRNA |
Sequence | 16 - GUCCAGUUUUCCCAGGAAUCCCU - 38 |
Evidence |
experimental
cloned [2-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004601 |
Description | Homo sapiens hsa-miR-145-3p mature miRNA |
Sequence | 54 - GGAUUCCUGGAAAUACUGUUCU - 75 |
Evidence |
experimental
cloned [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|