miRBase entry: hsa-mir-153-2

Stem-loop hsa-mir-153-2


Accession
MI0000464
Symbol
HGNC: MIR153-2
Description
Homo sapiens hsa-mir-153-2 precursor miRNA mir-153
Gene
family?
RF00650; mir-153

Literature search
69 open access papers mention hsa-mir-153-2
(684 sentences)

Sequence

22035 reads, 104 reads per million, 98 experiments
agcgguggccagugUCAUUUUUGUGAUGUUGCAGCUaguaauaugagcccagUUGCAUAGUCACAAAAGUGAUCauuggaaacugug
.(((((..(((((((((((((((((((..(((((((.((.......))..)))))))..))))))))))))).))))))..))))).

Structure
a     gg      -             GU       -a  aa 
 gcggu  ccagug UCAUUUUUGUGAU  UGCAGCU  gu  u
 |||||  |||||| |||||||||||||  |||||||  ||  a
 uguca  gguuaC AGUGAAAACACUG  ACGUUga  cg  u
g     aa      U             AU       cc  ag 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
chr7: 157574336-157574422 [-]

Disease association
hsa-mir-153-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-153-3p

Accession MIMAT0000439
Description Homo sapiens hsa-miR-153-3p mature miRNA
Sequence 53 - UUGCAUAGUCACAAAAGUGAUC - 74
Evidence experimental
cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-153-5p

Accession MIMAT0026480
Description Homo sapiens hsa-miR-153-5p mature miRNA
Sequence 15 - UCAUUUUUGUGAUGUUGCAGCU - 36
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45