miRBase entry: hsa-mir-126

Stem-loop hsa-mir-126


Accession
MI0000471
Symbol
HGNC: MIR126
Description
Homo sapiens hsa-mir-126 precursor miRNA mir-126
Gene
family?
RF00701; mir-126

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR126 is a microRNA that has been studied in various contexts. It has been found to be downregulated in the retinal tissue of streptozotocin-induced diabetic rats [PMC7932804]. In human lung tissue, there is a significant inverse correlation between ADAM9 expression and MIR126 expression [PMC9756782]. Disruption of MIR126, but not EGFL7, has been shown to lead to phenotypic changes in animals [PMC3960138]. MIR126 has also been found to induce complex metabolic reprogramming of MM cells, including activation of the autophagic pathway and downregulation of PDK and ACL activity [PMC5095004]. In AFS cells, MIR126 is detectable at the basal state [PMC4628318]. It plays a role in altering energy metabolism and facilitating tumor progression [PMC9779381]. Low levels of MIR126 are associated with a high risk for CoAD [PMC7123062]. The expression pattern of caspase 3 and MIR126 in EPCs is similar to that in their parent cells [PMC3830832]. In patients with PAAD, MIR126 is significantly associated with overall survival [PMC6005310]. The downregulation of miR-106a, miR-146a, miR-150, miR-16, miR-17, miR-19b, miR-20a, miR-223, miR-24, and miR-92a has also been observed in ovarian cancer samples compared to control samples [PMC6571871]. Housekeepers such as miRNA191 were measured against MIR126 and other microRNAs for comparison purposes.

Literature search
445 open access papers mention hsa-mir-126
(2777 sentences)

Sequence

718142 reads, 4188 reads per million, 135 experiments
cgcuggcgacgggaCAUUAUUACUUUUGGUACGCGcugugacacuucaaacUCGUACCGUGAGUAAUAAUGCGccguccacggca
.((((..(((((..(((((((((((.(((((((.....(((....)))....))))))).)))))))))))..)))))..)))).

Structure
c    gc     ga           U       CGcug   c 
 gcug  gacgg  CAUUAUUACUU UGGUACG     uga a
 ||||  |||||  ||||||||||| |||||||     |||  
 cggc  cugcc  GUAAUAAUGAG GCCAUGC     acu c
a    ac     GC           U       -Ucaa   u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr9: 136670602-136670686 [+]

Disease association
hsa-mir-126 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-126-5p

Accession MIMAT0000444
Description Homo sapiens hsa-miR-126-5p mature miRNA
Sequence 15 - CAUUAUUACUUUUGGUACGCG - 35
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-126-3p

Accession MIMAT0000445
Description Homo sapiens hsa-miR-126-3p mature miRNA
Sequence 52 - UCGUACCGUGAGUAAUAAUGCG - 73
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739