MIR126 is a microRNA implicated in various physiological and pathological processes, including oncogenesis and metabolic regulation [PMC7932804]. It has been observed that MIR126 expression is inversely correlated with ADAM9 in human lung tissue, suggesting a potential role in respiratory conditions [PMC9756782]. In diabetic retinopathy, MIR126 levels are downregulated, indicating its involvement in disease mechanisms [PMC7932804]. Moreover, MIR126 has been identified as a key regulator of metabolic reprogramming in multiple myeloma cells, influencing processes such as autophagy and lipid accumulation through HIF1α-dependent pathways [PMC5095004]. In the context of cancer progression, MIR126 alongside miR144 has been noted to alter energy metabolism [PMC9779381], and its low expression levels are associated with an increased risk for coronary artery disease (CoAD) [PMC7123062]. Additionally, the expression patterns of caspase 3 and MIR126 are consistent with those observed in their parent endothelial progenitor cells (EPCs) [PMC3830832], while their significant association with overall survival (OS) has been documented in pancreatic adenocarcinoma (PAAD) patients [PMC6005310]. In hepatocellular carcinoma (HCC), the downregulation of METTL14 leads to decreased m6A methylation of MIR126 which may contribute to metastasis and relapse [PMC7325074], reflecting its broader role as a miRNA frequently downregulated in various cancers including ovarian cancer [PMC6571871].
c gc ga U CGcug c gcug gacgg CAUUAUUACUU UGGUACG uga a |||| ||||| ||||||||||| ||||||| ||| cggc cugcc GUAAUAAUGAG GCCAUGC acu c a ac GC U -Ucaa u
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000444 |
Description | Homo sapiens hsa-miR-126-5p mature miRNA |
Sequence | 15 - CAUUAUUACUUUUGGUACGCG - 35 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000445 |
Description | Homo sapiens hsa-miR-126-3p mature miRNA |
Sequence | 52 - UCGUACCGUGAGUAAUAAUGCG - 73 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|