miRBase entry: hsa-mir-126

Stem-loop hsa-mir-126


Accession
MI0000471
Symbol
HGNC: MIR126
Description
Homo sapiens hsa-mir-126 precursor miRNA mir-126
Gene
family?
RF00701; mir-126

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR126 is a microRNA implicated in various physiological and pathological processes, including oncogenesis and metabolic regulation [PMC7932804]. It has been observed that MIR126 expression is inversely correlated with ADAM9 in human lung tissue, suggesting a potential role in respiratory conditions [PMC9756782]. In diabetic retinopathy, MIR126 levels are downregulated, indicating its involvement in disease mechanisms [PMC7932804]. Moreover, MIR126 has been identified as a key regulator of metabolic reprogramming in multiple myeloma cells, influencing processes such as autophagy and lipid accumulation through HIF1α-dependent pathways [PMC5095004]. In the context of cancer progression, MIR126 alongside miR144 has been noted to alter energy metabolism [PMC9779381], and its low expression levels are associated with an increased risk for coronary artery disease (CoAD) [PMC7123062]. Additionally, the expression patterns of caspase 3 and MIR126 are consistent with those observed in their parent endothelial progenitor cells (EPCs) [PMC3830832], while their significant association with overall survival (OS) has been documented in pancreatic adenocarcinoma (PAAD) patients [PMC6005310]. In hepatocellular carcinoma (HCC), the downregulation of METTL14 leads to decreased m6A methylation of MIR126 which may contribute to metastasis and relapse [PMC7325074], reflecting its broader role as a miRNA frequently downregulated in various cancers including ovarian cancer [PMC6571871].

Literature search
445 open access papers mention hsa-mir-126
(2777 sentences)

Sequence

718142 reads, 4188 reads per million, 135 experiments
cgcuggcgacgggaCAUUAUUACUUUUGGUACGCGcugugacacuucaaacUCGUACCGUGAGUAAUAAUGCGccguccacggca
.((((..(((((..(((((((((((.(((((((.....(((....)))....))))))).)))))))))))..)))))..)))).

Structure
c    gc     ga           U       CGcug   c 
 gcug  gacgg  CAUUAUUACUU UGGUACG     uga a
 ||||  |||||  ||||||||||| |||||||     |||  
 cggc  cugcc  GUAAUAAUGAG GCCAUGC     acu c
a    ac     GC           U       -Ucaa   u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr9: 136670602-136670686 [+]

Disease association
hsa-mir-126 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-126-5p

Accession MIMAT0000444
Description Homo sapiens hsa-miR-126-5p mature miRNA
Sequence 15 - CAUUAUUACUUUUGGUACGCG - 35
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-126-3p

Accession MIMAT0000445
Description Homo sapiens hsa-miR-126-3p mature miRNA
Sequence 52 - UCGUACCGUGAGUAAUAAUGCG - 73
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739