miRBase entry: hsa-mir-129-2

Stem-loop hsa-mir-129-2


Accession
MI0000473
Symbol
HGNC: MIR129-2
Description
Homo sapiens hsa-mir-129-2 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR129-2 is a microRNA whose methylation status has been implicated in the regulation of tumor suppressive pathways in various cancers. In the context of human diffuse intrinsic pontine glioma (DIPG), primary DIPG lines such as SF8628 have been utilized to validate the targeting of NG2 by MIR129-2 [PMC4494928]. The methylation of MIR129-2 has been associated with the methylation of other tumor suppressive microRNAs, including MIR34A, MIR124-1, MIR203, and MIR196B, as studied in multiple myeloma (MM), non-Hodgkin lymphoma (NHL), and chronic lymphocytic leukemia (CLL) patients [PMC3576298]. Notably, a CpG island is located near the promoter region of MIR129-2 but is absent from that of its counterpart, MIR129-1 [PMC3576298]. This presence of a CpG island may explain why methylation events are more frequently observed in the promoter region of MIR129-2. In clinical observations, a higher frequency of methylation at this site was noted in MM patients at diagnosis compared to those with monoclonal gammopathy of undetermined significance (MGUS), suggesting a potential role for this epigenetic modification in disease progression [PMC3576298].

Literature search
178 open access papers mention hsa-mir-129-2
(1306 sentences)

Sequence

75469 reads, 101.0 reads per million, 141 experiments
ugcccuucgcgaauCUUUUUGCGGUCUGGGCUUGCuguacauaacucaauagccggAAGCCCUUACCCCAAAAAGCAUuugcggagggcg
.((((((((((((((((((((.(((..(((((((((((..........)))))...))))))..))).))))))).))))))))))))).

Structure
u             -       C   CU      ---     acau 
 gcccuucgcgaau CUUUUUG GGU  GGGCUU   GCugu    a
 ||||||||||||| ||||||| |||  ||||||   |||||     
 cgggaggcguuUA GAAAAAC CCA  CCCGAA   cgaua    a
g             C       C   UU      ggc     acuc 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence was predicted based on homology to a verified miRNA cloned from mouse cerebellum [1]. Expression of this miRNA was subsequently verified in a human osteoblast sarcoma cell line [2]. Reference [2] named the human/mouse conserved sequence miR-129b, but subsequent genome searches suggest that the same mature sequence may be expressed from two predicted hairpin precursors in both human (this entry and MIR:MI0000252) and mouse (MIR:MI0000222 and MIR:MI0000585). Landgraf et al. show that the 5' product of mir-129-1 (MIR:MI0000222) is the predominant one, whereas both 5' and 3' products are significantly expressed from mir-129-2 (this entry) [3].

Genome context
chr11: 43581394-43581483 [+]

Disease association
hsa-mir-129-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-129-5p

Accession MIMAT0000242
Description Homo sapiens hsa-miR-129-5p mature miRNA
Sequence 15 - CUUUUUGCGGUCUGGGCUUGC - 35
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-129-2-3p

Accession MIMAT0004605
Description Homo sapiens hsa-miR-129-2-3p mature miRNA
Sequence 57 - AAGCCCUUACCCCAAAAAGCAU - 78
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739