MIR129-2 is a microRNA whose methylation status has been implicated in the regulation of tumor suppressive pathways in various cancers. In the context of human diffuse intrinsic pontine glioma (DIPG), primary DIPG lines such as SF8628 have been utilized to validate the targeting of NG2 by MIR129-2 [PMC4494928]. The methylation of MIR129-2 has been associated with the methylation of other tumor suppressive microRNAs, including MIR34A, MIR124-1, MIR203, and MIR196B, as studied in multiple myeloma (MM), non-Hodgkin lymphoma (NHL), and chronic lymphocytic leukemia (CLL) patients [PMC3576298]. Notably, a CpG island is located near the promoter region of MIR129-2 but is absent from that of its counterpart, MIR129-1 [PMC3576298]. This presence of a CpG island may explain why methylation events are more frequently observed in the promoter region of MIR129-2. In clinical observations, a higher frequency of methylation at this site was noted in MM patients at diagnosis compared to those with monoclonal gammopathy of undetermined significance (MGUS), suggesting a potential role for this epigenetic modification in disease progression [PMC3576298].
u - C CU --- acau gcccuucgcgaau CUUUUUG GGU GGGCUU GCugu a ||||||||||||| ||||||| ||| |||||| ||||| cgggaggcguuUA GAAAAAC CCA CCCGAA cgaua a g C C UU ggc acuc
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000242 |
| Description | Homo sapiens hsa-miR-129-5p mature miRNA |
| Sequence | 15 - CUUUUUGCGGUCUGGGCUUGC - 35 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004605 |
| Description | Homo sapiens hsa-miR-129-2-3p mature miRNA |
| Sequence | 57 - AAGCCCUUACCCCAAAAAGCAU - 78 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
|