Accession
MI0000473
Symbol
HGNC:
MIR129-2
Description
Homo sapiens
hsa-mir-129-2 precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR129-2 is a microRNA that has been studied in various types of cancer, including Diffuse Intrinsic Pontine Glioma (DIPG) [PMC4494928]. In order to validate the role of MIR129-2 in targeting NG2 in human DIPG, primary DIPG lines (SF8628) were used [PMC4494928]. The association between MIR129-2 methylation and other tumor suppressive microRNA methylation, such as MIR34A, MIR124-1, MIR203, and MIR196B, was examined in patients with Multiple Myeloma (MM), Non-Hodgkin Lymphoma (NHL), and Chronic Lymphocytic Leukemia (CLL) using a Χ2 test [PMC3576298]. It was found that a CpG island is present near the promoter of MIR129-2 but not MIR129-1 [PMC3576298]. Furthermore, the frequency of MIR129-2 methylation was higher in MM patients at diagnosis compared to patients with Monoclonal Gammopathy of Undetermined Significance (MGUS) [PMC3576298]. The difference in frequency between MM and MGUS was statistically significant with a p-value of 0.023 [PMC3576298]. In summary, the role of MIR129-2 in targeting NG2 in human DIPG was validated using primary DIPG lines. Additionally, the association between methylation of MIR129-2 and other tumor suppressive microRNAs was examined in MM, NHL, and CLL patients. The presence of a CpG island near the promoter of MIR129-2 but not MIR129-1 suggests differential regulation between these two microRNAs. Furthermore, higher frequency of methylation at the CpG island was observed in MM patients at diagnosis compared to patients with MGUS.
Literature search
136 open access papers mention hsa-mir-129-2
(1245 sentences)
(1245 sentences)
Sequence
66020
reads,
302
reads per million, 95 experiments
ugcccuucgcgaauCUUUUUGCGGUCUGGGCUUGCuguacauaacucaauagccggAAGCCCUUACCCCAAAAAGCAUuugcggagggcg
.((((((((((((((((((((.(((..(((((((((((..........)))))...))))))..))).))))))).))))))))))))).
.((((((((((((((((((((.(((..(((((((((((..........)))))...))))))..))).))))))).))))))))))))).
Structure
u - C CU --- acau gcccuucgcgaau CUUUUUG GGU GGGCUU GCugu a ||||||||||||| ||||||| ||| |||||| ||||| cgggaggcguuUA GAAAAAC CCA CCCGAA cgaua a g C C UU ggc acuc
Annotation confidence
High
Do you think this miRNA is real?
Comments
This miRNA sequence was predicted based on homology to a verified miRNA cloned from mouse cerebellum [1]. Expression of this miRNA was subsequently verified in a human osteoblast sarcoma cell line [2]. Reference [2] named the human/mouse conserved sequence miR-129b, but subsequent genome searches suggest that the same mature sequence may be expressed from two predicted hairpin precursors in both human (this entry and MIR:MI0000252) and mouse (MIR:MI0000222 and MIR:MI0000585). Landgraf et al. show that the 5' product of mir-129-1 (MIR:MI0000222) is the predominant one, whereas both 5' and 3' products are significantly expressed from mir-129-2 (this entry) [3].
Genome context
chr11: 43581394-43581483 [+]
Disease association
hsa-mir-129-2 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-129-5p
| Accession | MIMAT0000242 |
| Description | Homo sapiens hsa-miR-129-5p mature miRNA |
| Sequence | 15 - CUUUUUGCGGUCUGGGCUUGC - 35 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
Mature hsa-miR-129-2-3p
| Accession | MIMAT0004605 |
| Description | Homo sapiens hsa-miR-129-2-3p mature miRNA |
| Sequence | 57 - AAGCCCUUACCCCAAAAAGCAU - 78 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
References
|
