MIR134 is a brain-enriched microRNA implicated in regulating dendritic spine morphology and is associated with various neurological processes and disorders [PMC6994828]. It has been observed that increased levels of MIR134 are present in experimental and human temporal lobe epilepsy, suggesting its involvement in epileptogenesis [PMC6994828]. In a study, the knockdown of MIR134 in the ventral hippocampus (vHP) of cocaine-exposed (CE) mice via adeno-associated virus resulted in enhanced long-term potentiation, indicating its negative regulatory role on synaptic plasticity [PMC6994828]. Furthermore, the reduction of MIR134 expression was found to alleviate anxiety-like and depression-like behaviors in CE mice, linking MIR134 to cocaine-use-related psychiatric issues [PMC6994828]. Previous research has shown that targeting MIR134 with antagomirs can protect against evoked seizures, reinforcing its potential as a therapeutic target for epilepsy [PMC8178478]. Additionally, the expression of MIR134 near synaptic sites on dendrites suggests its involvement in local synaptic functions [PMC6994828]. Overall, these findings highlight the significance of MIR134 as a regulatory molecule with potential implications for neurodegenerative diseases and psychiatric disorders related to substance abuse.
c gU U -A G --- g agggu GUGACUGG UG CCA AGGG Gcau c ||||| |||||||| || ||| |||| |||| a ucccA CACUGAUC AC GGU UCCc ugug c c AC C CG G acu u
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000447 |
| Description | Homo sapiens hsa-miR-134-5p mature miRNA |
| Sequence | 8 - UGUGACUGGUUGACCAGAGGGG - 29 |
| Evidence |
experimental
cloned [2-4], Illumina [5] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026481 |
| Description | Homo sapiens hsa-miR-134-3p mature miRNA |
| Sequence | 46 - CCUGUGGGCCACCUAGUCACCAA - 68 |
| Evidence |
experimental
Illumina [5] |
| Database links |
|
| Predicted targets |
|
|