miRBase entry: hsa-mir-134

Stem-loop hsa-mir-134


Accession
MI0000474
Symbol
HGNC: MIR134
Description
Homo sapiens hsa-mir-134 precursor miRNA mir-134
Gene
family?
RF00699; mir-134

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR134 is a brain-enriched microRNA implicated in regulating dendritic spine morphology and is associated with various neurological processes and disorders [PMC6994828]. It has been observed that increased levels of MIR134 are present in experimental and human temporal lobe epilepsy, suggesting its involvement in epileptogenesis [PMC6994828]. In a study, the knockdown of MIR134 in the ventral hippocampus (vHP) of cocaine-exposed (CE) mice via adeno-associated virus resulted in enhanced long-term potentiation, indicating its negative regulatory role on synaptic plasticity [PMC6994828]. Furthermore, the reduction of MIR134 expression was found to alleviate anxiety-like and depression-like behaviors in CE mice, linking MIR134 to cocaine-use-related psychiatric issues [PMC6994828]. Previous research has shown that targeting MIR134 with antagomirs can protect against evoked seizures, reinforcing its potential as a therapeutic target for epilepsy [PMC8178478]. Additionally, the expression of MIR134 near synaptic sites on dendrites suggests its involvement in local synaptic functions [PMC6994828]. Overall, these findings highlight the significance of MIR134 as a regulatory molecule with potential implications for neurodegenerative diseases and psychiatric disorders related to substance abuse.

Literature search
409 open access papers mention hsa-mir-134
(1653 sentences)

Sequence

78836 reads, 106.0 reads per million, 172 experiments
cagggugUGUGACUGGUUGACCAGAGGGGcaugcacuguguucacCCUGUGGGCCACCUAGUCACCAAcccuc
.(((((..((((((((.((.(((.((((((((.....))))...)))).)))..)).))))))))..))))).

Structure
c     gU        U  -A   G    ---    g 
 agggu  GUGACUGG UG  CCA AGGG   Gcau c
 |||||  |||||||| ||  ||| ||||   |||| a
 ucccA  CACUGAUC AC  GGU UCCc   ugug c
c     AC        C  CG   G    acu    u 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-134 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr14: 101054687-101054759 [+]
Clustered miRNAs
15 other miRNAs are < 10 kb from hsa-mir-134
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-134 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-134-5p

Accession MIMAT0000447
Description Homo sapiens hsa-miR-134-5p mature miRNA
Sequence 8 - UGUGACUGGUUGACCAGAGGGG - 29
Evidence experimental
cloned [2-4], Illumina [5]
Database links
Predicted targets

Mature hsa-miR-134-3p

Accession MIMAT0026481
Description Homo sapiens hsa-miR-134-3p mature miRNA
Sequence 46 - CCUGUGGGCCACCUAGUCACCAA - 68
Evidence experimental
Illumina [5]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  4. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706

  5. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45