MIR134 is a brain-enriched miRNA that is involved in various processes such as cell growth, differentiation, synaptic plasticity, neuroinflammation, and apoptosis [PMC6994828]. It has been found that knockdown of MIR134 in the ventral hippocampus (vHP) enhances the development of long-term potentiation (LTP) in CA1 pyramidal neurons [PMC6994828]. Dysregulation of miRNA biogenesis and increased levels of MIR134 have been observed in epilepsy and neurodegenerative disorders [PMC6994828]. In animal models, reducing brain levels of MIR134 has been shown to protect against seizures [PMC8178478]. In the context of cocaine exposure, knockdown of MIR134 expression in the vHP reduces anxiety-like and depression-like behaviors [PMC6994828]. MIR134 is expressed near synaptic sites on dendrites and enriched in synaptoneurosome [PMC6994828]. It has also been shown to be involved in cell proliferation and migration regulation [PMC5928554]. Additionally, MIR134 is a putative regulator of INA (inhibin alpha subunit) and acts on translation initiation factor like 5A-1/2 [PMC7281098] [PMC7753210]. Overall, these findings suggest that MIR134 plays a significant role in various neurological processes and may have therapeutic potential for conditions such as epilepsy and cocaine addiction.
c gU U -A G --- g agggu GUGACUGG UG CCA AGGG Gcau c ||||| |||||||| || ||| |||| |||| a ucccA CACUGAUC AC GGU UCCc ugug c c AC C CG G acu u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000447 |
Description | Homo sapiens hsa-miR-134-5p mature miRNA |
Sequence | 8 - UGUGACUGGUUGACCAGAGGGG - 29 |
Evidence |
experimental
cloned [2-4], Illumina [5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026481 |
Description | Homo sapiens hsa-miR-134-3p mature miRNA |
Sequence | 46 - CCUGUGGGCCACCUAGUCACCAA - 68 |
Evidence |
experimental
Illumina [5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|