WARNING: This summary was generated by AI. MIR136 is a microRNA observed to increase in expression levels during the transition of preadipocytes to mature adipocytes, particularly between the 8th and 10th day of adipocyte development [PMC9928478]. Concurrently, the expression of PPARGC1B, a gene implicated in this differentiation process, decreases [PMC9928478]. The study conducted an analysis to understand MIR136's role in preadipocyte proliferation and differentiation, as well as its regulatory interactions with PPARGC1B and other key adipogenic factors such as PPARγ, C/EBPα, and IGF1 [PMC9928478].
u g C UUU uuc gagcccuc gaggACUC AUUUG UGAUGAUGGA u |||||||| |||||||| ||||| |||||||||| u cuugggag cuUCUGAG UAAAC GCUACUACcu a u a - UCU cgu
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000448 |
| Description | Homo sapiens hsa-miR-136-5p mature miRNA |
| Sequence | 15 - ACUCCAUUUGUUUUGAUGAUGGA - 37 |
| Evidence |
experimental
cloned [2-4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004606 |
| Description | Homo sapiens hsa-miR-136-3p mature miRNA |
| Sequence | 49 - CAUCAUCGUCUCAAAUGAGUCU - 70 |
| Evidence |
experimental
cloned [4] |
| Database links |
|
| Predicted targets |
|
|