MIR136 is a microRNA that plays a role in the proliferation and differentiation of preadipocytes. After preadipocytes successfully differentiate into mature adipocytes, the expression of PPARGC1B decreases, while the level of MIR136 increases [PMC9928478]. The regulatory mechanism of MIR136 involves the function of PPARGC1B, PPARγ, C/EBPα, and IGF1 [PMC9928478]. MIR136 is a small non-coding RNA molecule that regulates gene expression at the post-transcriptional level. It has been found to be involved in various biological processes, including adipogenesis [PMC9928478]. In the context of preadipocyte differentiation into mature adipocytes, MIR136 levels increase while PPARGC1B expression decreases [PMC9928478'>PMC9928478'>PMC9928478]. The role of MIR136 in preadipocyte proliferation and differentiation has been investigated. It is suggested that MIR136 may regulate these processes through its interaction with key transcription factors involved in adipogenesis, such as PPARγ and C/EBPα [PMC9928478]. Additionally, IGF1 may also be involved in the regulatory mechanism of MIR136 during preadipocyte differentiation [PMC9928478]. In summary, MIR136 is a microRNA that plays a role in regulating preadipocyte proliferation and differentiation. Its expression increases during adipogenesis while PPARGC1B levels decrease. The regulatory mechanism involves interactions with key transcription factors such as PPARγ and C/EBPα as well as potential involvement of IGF1 [PMC9928478].
u g C UUU uuc gagcccuc gaggACUC AUUUG UGAUGAUGGA u |||||||| |||||||| ||||| |||||||||| u cuugggag cuUCUGAG UAAAC GCUACUACcu a u a - UCU cgu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000448 |
Description | Homo sapiens hsa-miR-136-5p mature miRNA |
Sequence | 15 - ACUCCAUUUGUUUUGAUGAUGGA - 37 |
Evidence |
experimental
cloned [2-4] |
Database links | |
Predicted targets |
Accession | MIMAT0004606 |
Description | Homo sapiens hsa-miR-136-3p mature miRNA |
Sequence | 49 - CAUCAUCGUCUCAAAUGAGUCU - 70 |
Evidence |
experimental
cloned [4] |
Database links | |
Predicted targets |
|