Accession
MI0000477
Symbol
HGNC:
MIR146A
Description
Homo sapiens
hsa-mir-146a precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR146A is a microRNA that has been studied in various contexts [PMC10110697]. It has been shown to play a role in chondrogenesis [PMC10110697]. Additionally, MIR146A has been found to have a protective role in diabetic nephropathy [PMC5354466]. The effects of MIR146A are likely mediated by downstream targets, including CNP-MIR146A [PMC10129905]. The binding sites of MIR146A have been analyzed in the intergenic region [PMC6050289]. MIR146A has also been found to enhance the expression and activation of STAT1, which is a direct target of MIR146A [PMC9125934]. The expression and role of MIR146A are unclear in several cancers, including colon cancer [PMC3985145]. The oxidation of MIR146A has been measured using area under the curve measurements [PMC9766199]. Overexpression of pre-MIR146A resulted in increased expression in HEK293 cells [PMC6050289]. Interference with endogenous MIR146A using a miR146-sponge plasmid was done in HBV-carrying mice [PMC4876503]. Engineered exosomes have been suggested as a possible solution for controlling the expression of MIR146A for therapeutic purposes [PMC9922687]. Mice lacking Apoe have shown increased susceptibility to atherosclerosis due to the control exerted by Apoe on the expression of MIR146A [PMC6023389]. Decreased expression levels of MIR145 and MIRA6 were associated with 5q- myelodysplastic syndrome (MDS) deletion syndrome and distant metastases among gastric cancer patients, respectively [PMC4926477] [PMC6778823]. Serum levels of miR-155, miR19a, miR20a, miR30a-3p were also found to be differentially expressed among patients with graft-versus-host disease (GVHD) compared to healthy controls [PMC8170404]. Serum levels were measured pre-transplant and two weeks after hematopoietic cell transplantation (HCT) [PMC8170404]. Serum MIR146A was significantly reduced in esophageal squamous-cell cancer (ESCC) patients [PMC6301302]. MIR146A has been found to be a potential target in mesenchymal stem cell (MSC)-based osteoarthritis (OA) therapy [PMC10110697]. The interaction of MIR146A with predicted sites and the subsequent repression of FANCM has been confirmed using a 3'UTR luciferase reporter assay [PMC5216775]. MIR146A has been shown to be a dominant negative regulator of NFκB by suppressing TRAF6 and activating IKK and NFκB [PMC6651735]. The function of MIR146A differs during the demyelination vs. remyelination process, with continuous infusion of miR-146a mimics promoting remyelination by suppressing inflammatory microglial activation [PMC7468479]. In human T cells, MIR146A is expressed at low levels in naïve T lymphocytes and is induced upon TCR stimulation, consistent with its expression being dependent on NF-κB induction [PMC4641946]. Finally, MIR146A, miR34a, and miR-126 have been found to participate in the inflammatory response after brain injury [PMC8109138].
Literature search
749 open access papers mention hsa-mir-146a
(6781 sentences)
(6781 sentences)
Sequence
319175
reads,
1682
reads per million, 137 experiments
ccgauguguauccucagcuuUGAGAACUGAAUUCCAUGGGUUgugucagugucagaCCUCUGAAAUUCAGUUCUUCAGcugggauaucucugucaucgu
.(((((.((((((.(((((..((((((((((((.((.(((((.((.......))))))).)).)))))))))))).)))))))))))......))))).
.(((((.((((((.(((((..((((((((((((.((.(((((.((.......))))))).)).)))))))))))).)))))))))))......))))).
Structure
c -----u u uU C U g uc cgaug guaucc cagcu GAGAACUGAAUU CA GGGUU ug a ||||| |||||| ||||| |||||||||||| || ||||| || g gcuac uauagg gucGA UUCUUGACUUAA GU UCCag ac u u ugucuc - -C A C - ug
Annotation confidence
High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human [2,3].
Genome context
chr5: 160485352-160485450 [+]
Disease association
hsa-mir-146a is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-146a-5p
| Accession | MIMAT0000449 |
| Description | Homo sapiens hsa-miR-146a-5p mature miRNA |
| Sequence | 21 - UGAGAACUGAAUUCCAUGGGUU - 42 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
Mature hsa-miR-146a-3p
| Accession | MIMAT0004608 |
| Description | Homo sapiens hsa-miR-146a-3p mature miRNA |
| Sequence | 57 - CCUCUGAAAUUCAGUUCUUCAG - 78 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
References
|
