miRBase entry: hsa-mir-146a

Stem-loop hsa-mir-146a


Accession
MI0000477
Symbol
HGNC: MIR146A
Description
Homo sapiens hsa-mir-146a precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR146A, a microRNA, plays a crucial role in various biological processes, including chondrogenesis, where its absence in knockout MSCs confirmed its function [PMC10110697]. It also exhibits a protective role in diabetic nephropathy and influences lung structure and function through its downstream targets [PMC5354466; PMC10129905].]. MIR146A directly targets STAT1, impacting its expression and activation [PMC9125934], and its expression levels are notably altered in various diseases such as lupus nephritis and esophageal squamous-cell cancer [PMC9013931; PMC6301302].. Variants within the MIR146A gene promoter may affect its expression [PMC9078850], suggesting potential therapeutic applications in MSC-based osteoarthritis therapy [PMC10110697]. Moreover, MIR146A is implicated in the immune response as it is differentially expressed between naïve and memory T cells and is induced by TCR stimulation [PMC4641946]. It also acts as a negative regulator of NFκB by suppressing TRAF6, highlighting its anti-inflammatory potential which could be harnessed using engineered exosomes for therapeutic delivery [PMC6651735; PMC9922687]..

Literature search
749 open access papers mention hsa-mir-146a
(6781 sentences)

Sequence

319175 reads, 1010 reads per million, 137 experiments
ccgauguguauccucagcuuUGAGAACUGAAUUCCAUGGGUUgugucagugucagaCCUCUGAAAUUCAGUUCUUCAGcugggauaucucugucaucgu
.(((((.((((((.(((((..((((((((((((.((.(((((.((.......))))))).)).)))))))))))).)))))))))))......))))).

Structure
c     -----u      u     uU            C  U     g  uc 
 cgaug      guaucc cagcu  GAGAACUGAAUU CA GGGUU ug  a
 |||||      |||||| |||||  |||||||||||| || ||||| ||  g
 gcuac      uauagg gucGA  UUCUUGACUUAA GU UCCag ac  u
u     ugucuc      -     -C            A  C     -  ug 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human [2,3].

Genome context
chr5: 160485352-160485450 [+]

Disease association
hsa-mir-146a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-146a-5p

Accession MIMAT0000449
Description Homo sapiens hsa-miR-146a-5p mature miRNA
Sequence 21 - UGAGAACUGAAUUCCAUGGGUU - 42
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-146a-3p

Accession MIMAT0004608
Description Homo sapiens hsa-miR-146a-3p mature miRNA
Sequence 57 - CCUCUGAAAUUCAGUUCUUCAG - 78
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 15800047
    Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
    "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
    "Proc Natl Acad Sci U S A (2005) 102:5570-5575