miRBase entry: hsa-mir-154

Stem-loop hsa-mir-154


Accession
MI0000480
Symbol
HGNC: MIR154
Description
Homo sapiens hsa-mir-154 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR154 is a microRNA belonging to a large cluster located on chromosome 14q32.31, known to contain over 40 intergenic microRNAs, and is transcribed from the maternal chromosome [PMC3919614], [PMC7794215]. It is part of the miR655 miRNA cluster, which includes several other microRNAs with available expression data [PMC7465874]. MIR154 has been implicated in the regulation of fibrosis in various organs and has been highlighted as a potential diagnostic biomarker for distinguishing between pulmonary granuloma and adenocarcinoma [PMC7794215], [PMC9400731]. It has also been associated with negative regulation in gene sets related to myocardial fibrosis and the metastatic behavior of non-small lung cancer cells [PMC6465659]. In studies on immune cells, MIR154 expression was found to be downregulated in T lymphocytes and monocytes but was higher in B cells compared to neutrophils; however, its expression was consistently upregulated in human cell lines upon Snail overexpression [PMC6122344]. Additionally, MIR154 has been shown to be down-regulated in HPV16-positive cervical carcinoma compared to normal cervix samples but not vice versa [PMC4288222]. These findings suggest that MIR154 plays a complex role across various biological processes and diseases.

Literature search
59 open access papers mention hsa-mir-154
(142 sentences)

Sequence

2304 reads, 16 reads per million, 69 experiments
gugguacuugaagaUAGGUUAUCCGUGUUGCCUUCGcuuuauuugugacgAAUCAUACACGGUUGACCUAUUuuucaguaccaa
.(((((((.((((((((((((.((((((((.(.((((.......)))).)...)).)))))).)))))))))))).))))))).

Structure
g       u            U      -  --C U    uu 
 ugguacu gaagaUAGGUUA CCGUGU UG   C UCGc  u
 ||||||| |||||||||||| |||||| ||   | ||||  a
 accauga uuuUUAUCCAGU GGCACA AC   g agug  u
a       c            U      U  UAA c    uu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101059755-101059838 [+]
Clustered miRNAs
14 other miRNAs are < 10 kb from hsa-mir-154
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-154 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-154-5p

Accession MIMAT0000452
Description Homo sapiens hsa-miR-154-5p mature miRNA
Sequence 15 - UAGGUUAUCCGUGUUGCCUUCG - 36
Evidence experimental
cloned [3-4]
Database links
Predicted targets

Mature hsa-miR-154-3p

Accession MIMAT0000453
Description Homo sapiens hsa-miR-154-3p mature miRNA
Sequence 51 - AAUCAUACACGGUUGACCUAUU - 72
Evidence experimental
cloned [2,4], Northern [2]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  4. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706