MIR154 is a microRNA that belongs to the MIR154 family [PMC7794215]. It is transcribed from the maternal chromosome and is part of the Dlk1-Dio3 imprinted domain [PMC3919614]. MIR154 has been implicated in fibrosis of various organs [PMC7794215]. It has also been identified as a diagnostic biomarker for discriminating pulmonary granuloma and adenocarcinoma [PMC9400731]. In HPV16-positive cervical carcinoma, MIR154 is down-regulated compared to normal cervix samples [PMC4288222]. In T and B lymphocytes, the expression of MIR154 is decreased [PMC6122344]. The expression of MIR154, along with other genes in the imprinted domain, can be affected by Snail overexpression in tumors [PMC6122344]. SNP rs1700 overlaps with the predicted binding site for MIR154, suggesting its involvement in myocardial fibrosis and regulating metastatic behavior in lung cancer cells [PMC6465659]. The miR655 miRNA cluster contains several miRNAs including MIR154 that are overexpressed in medullary thyroid carcinoma samples [PMC7465874]. Overall, these findings highlight the importance of MIR154 in various biological processes and its potential as a diagnostic biomarker [PMC7794215, PMC3919614, PMC9400731, PMC4288222, PMC6122344, PMC6465659, PMC7465874]..
g u U - --C U uu ugguacu gaagaUAGGUUA CCGUGU UG C UCGc u ||||||| |||||||||||| |||||| || | |||| a accauga uuuUUAUCCAGU GGCACA AC g agug u a c U U UAA c uu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000452 |
Description | Homo sapiens hsa-miR-154-5p mature miRNA |
Sequence | 15 - UAGGUUAUCCGUGUUGCCUUCG - 36 |
Evidence |
experimental
cloned [3-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000453 |
Description | Homo sapiens hsa-miR-154-3p mature miRNA |
Sequence | 51 - AAUCAUACACGGUUGACCUAUU - 72 |
Evidence |
experimental
cloned [2,4], Northern [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|