miRBase entry: hsa-mir-154

Stem-loop hsa-mir-154


Accession
MI0000480
Symbol
HGNC: MIR154
Description
Homo sapiens hsa-mir-154 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR154 is a microRNA that belongs to the MIR154 family [PMC7794215]. It is transcribed from the maternal chromosome and is part of the Dlk1-Dio3 imprinted domain [PMC3919614]. MIR154 has been implicated in fibrosis of various organs [PMC7794215]. It has also been identified as a diagnostic biomarker for discriminating pulmonary granuloma and adenocarcinoma [PMC9400731]. In HPV16-positive cervical carcinoma, MIR154 is down-regulated compared to normal cervix samples [PMC4288222]. In T and B lymphocytes, the expression of MIR154 is decreased [PMC6122344]. The expression of MIR154, along with other genes in the imprinted domain, can be affected by Snail overexpression in tumors [PMC6122344]. SNP rs1700 overlaps with the predicted binding site for MIR154, suggesting its involvement in myocardial fibrosis and regulating metastatic behavior in lung cancer cells [PMC6465659]. The miR655 miRNA cluster contains several miRNAs including MIR154 that are overexpressed in medullary thyroid carcinoma samples [PMC7465874]. Overall, these findings highlight the importance of MIR154 in various biological processes and its potential as a diagnostic biomarker [PMC7794215, PMC3919614, PMC9400731, PMC4288222, PMC6122344, PMC6465659, PMC7465874]..

Literature search
59 open access papers mention hsa-mir-154
(142 sentences)

Sequence

2304 reads, 63 reads per million, 69 experiments
gugguacuugaagaUAGGUUAUCCGUGUUGCCUUCGcuuuauuugugacgAAUCAUACACGGUUGACCUAUUuuucaguaccaa
.(((((((.((((((((((((.((((((((.(.((((.......)))).)...)).)))))).)))))))))))).))))))).

Structure
g       u            U      -  --C U    uu 
 ugguacu gaagaUAGGUUA CCGUGU UG   C UCGc  u
 ||||||| |||||||||||| |||||| ||   | ||||  a
 accauga uuuUUAUCCAGU GGCACA AC   g agug  u
a       c            U      U  UAA c    uu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101059755-101059838 [+]
Clustered miRNAs
14 other miRNAs are < 10 kb from hsa-mir-154
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-154 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-154-5p

Accession MIMAT0000452
Description Homo sapiens hsa-miR-154-5p mature miRNA
Sequence 15 - UAGGUUAUCCGUGUUGCCUUCG - 36
Evidence experimental
cloned [3-4]
Database links
Predicted targets

Mature hsa-miR-154-3p

Accession MIMAT0000453
Description Homo sapiens hsa-miR-154-3p mature miRNA
Sequence 51 - AAUCAUACACGGUUGACCUAUU - 72
Evidence experimental
cloned [2,4], Northern [2]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  4. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706