WARNING: This summary was generated by AI. MIR154 is a microRNA belonging to a large cluster located on chromosome 14q32.31, known to contain over 40 intergenic microRNAs, and is transcribed from the maternal chromosome [PMC3919614], [PMC7794215]. It is part of the miR655 miRNA cluster, which includes several other microRNAs with available expression data [PMC7465874]. MIR154 has been implicated in the regulation of fibrosis in various organs and has been highlighted as a potential diagnostic biomarker for distinguishing between pulmonary granuloma and adenocarcinoma [PMC7794215], [PMC9400731]. It has also been associated with negative regulation in gene sets related to myocardial fibrosis and the metastatic behavior of non-small lung cancer cells [PMC6465659]. In studies on immune cells, MIR154 expression was found to be downregulated in T lymphocytes and monocytes but was higher in B cells compared to neutrophils; however, its expression was consistently upregulated in human cell lines upon Snail overexpression [PMC6122344]. Additionally, MIR154 has been shown to be down-regulated in HPV16-positive cervical carcinoma compared to normal cervix samples but not vice versa [PMC4288222]. These findings suggest that MIR154 plays a complex role across various biological processes and diseases.
g u U - --C U uu ugguacu gaagaUAGGUUA CCGUGU UG C UCGc u ||||||| |||||||||||| |||||| || | |||| a accauga uuuUUAUCCAGU GGCACA AC g agug u a c U U UAA c uu
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000452 |
| Description | Homo sapiens hsa-miR-154-5p mature miRNA |
| Sequence | 15 - UAGGUUAUCCGUGUUGCCUUCG - 36 |
| Evidence |
experimental
cloned [3-4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000453 |
| Description | Homo sapiens hsa-miR-154-3p mature miRNA |
| Sequence | 51 - AAUCAUACACGGUUGACCUAUU - 72 |
| Evidence |
experimental
cloned [2,4], Northern [2] |
| Database links |
|
| Predicted targets |
|
|