MIR184 is a microRNA implicated in the regulation of gene expression, and its genetic mutations have been identified in a limited number of genes associated with various diseases [PMC9025197]. In the context of hepatocellular carcinoma (HCC), MIR184 is among several oncogenic microRNAs (OncomiRs) that exhibit significant changes in expression profiles, suggesting a potential role in the pathogenesis or progression of this type of cancer [PMC9741442].
c g c c a c - ug cagucac u cccuuauca uuuucc g ccagc uuug a ||||||| | ||||||||| |||||| | ||||| |||| guuagug a GGGAAUAGU AAGAGG C GGUug gaau c a g U C - A u gu
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000454 |
| Description | Homo sapiens hsa-miR-184 mature miRNA |
| Sequence | 53 - UGGACGGAGAACUGAUAAGGGU - 74 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|