miRBase entry: hsa-mir-190a

Stem-loop hsa-mir-190a


Accession
MI0000486
Symbol
HGNC: MIR190A
Description
Homo sapiens hsa-mir-190a precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR190A, a microRNA, has been implicated in various biological pathways and diseases, including its significant role in the microbiota-gut-brain (MGB) axis [PMC8615526]. While it is listed among miRNAs that could be responsible for early onset of fibrosis in double-infected transplanted livers, its specific role in the downregulation of miRNAs associated with extracellular matrix remodeling has not been detailed [PMC8869900]. MIR190A has been shown to facilitate bladder cancer (BC) invasion and autophagy by stabilizing ATG7 mRNA through binding to its 3′UTR [PMC8514698], [PMC7226452]. This regulatory effect is further supported by evidence from ectopic expression studies and the use of MIR190A specific antisense in BC cells [PMC6468970]. The overexpression of MIR190A promotes BC invasion and autophagy, while its inhibition leads to increased PHLPP1 protein expression and reduced ATG7 protein expression [PMC6468970]. The upregulation of MIR190A has also been observed in human invasive BCs and is associated with increased ATG7 mRNA stabilization, further linking it to BC invasion both in vitro and in vivo [PMC6468970].

Literature search
43 open access papers mention hsa-mir-190a
(214 sentences)

Sequence

8022 reads, 33 reads per million, 94 experiments
ugcaggccucugugUGAUAUGUUUGAUAUAUUAGGUuguuauuuaauccaaCUAUAUAUCAAACAUAUUCCUacagugucuugcc
.(((((.(.(((((.((((((((((((((((..(((((..........)))))))))))))))))))))..))))).).))))).

Structure
u     c u     -U                UA     uuau 
 gcagg c cugug  GAUAUGUUUGAUAUAU  GGUug    u
 ||||| | |||||  ||||||||||||||||  |||||     
 cguuc g gacaU  UUAUACAAACUAUAUA  UCaac    u
c     u u     CC                --     cuaa 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
chr15: 62823957-62824041 [+]

Disease association
hsa-mir-190a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-190a-5p

Accession MIMAT0000458
Description Homo sapiens hsa-miR-190a-5p mature miRNA
Sequence 15 - UGAUAUGUUUGAUAUAUUAGGU - 36
Evidence experimental
cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-190a-3p

Accession MIMAT0026482
Description Homo sapiens hsa-miR-190a-3p mature miRNA
Sequence 52 - CUAUAUAUCAAACAUAUUCCU - 72
Evidence experimental
Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45