WARNING: This summary was generated by AI. MIR190A, a microRNA, has been implicated in various biological pathways and diseases, including its significant role in the microbiota-gut-brain (MGB) axis [PMC8615526]. While it is listed among miRNAs that could be responsible for early onset of fibrosis in double-infected transplanted livers, its specific role in the downregulation of miRNAs associated with extracellular matrix remodeling has not been detailed [PMC8869900]. MIR190A has been shown to facilitate bladder cancer (BC) invasion and autophagy by stabilizing ATG7 mRNA through binding to its 3′UTR [PMC8514698], [PMC7226452]. This regulatory effect is further supported by evidence from ectopic expression studies and the use of MIR190A specific antisense in BC cells [PMC6468970]. The overexpression of MIR190A promotes BC invasion and autophagy, while its inhibition leads to increased PHLPP1 protein expression and reduced ATG7 protein expression [PMC6468970]. The upregulation of MIR190A has also been observed in human invasive BCs and is associated with increased ATG7 mRNA stabilization, further linking it to BC invasion both in vitro and in vivo [PMC6468970].
u c u -U UA uuau gcagg c cugug GAUAUGUUUGAUAUAU GGUUG u ||||| | ||||| |||||||||||||||| ||||| cguuc g gacaU UUAUACAAACUAUAUA UCAac u c u u CC -- cuaa
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000458 |
| Description | Homo sapiens hsa-miR-190a-5p mature miRNA |
| Sequence | 15 - UGAUAUGUUUGAUAUAUUAGGUUG - 38 |
| Evidence |
experimental
cloned [2], Illumina [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026482 |
| Description | Homo sapiens hsa-miR-190a-3p mature miRNA |
| Sequence | 51 - ACUAUAUAUCAAACAUAUUCCU - 72 |
| Evidence |
experimental
Illumina [3] |
| Database links |
|
| Predicted targets |
|
|