WARNING: This summary was generated by AI. Hsa-mir-195 is a microRNA implicated in various cellular processes, including those relevant to cancer biology [PMC5706292]. In a study using MCF-7 cells, a model for breast cancer, cells transfected with hsa-mir-195 showed a notable reduction in cytosolic lipid droplets compared to those transfected with a non-specific scrambled control [PMC4668367]. However, the overexpression of hsa-mir-195 did not significantly alter the mRNA levels of CYP27B1, an enzyme involved in vitamin D metabolism [PMC4668367]. In contrast, the inhibition of hsa-mir-195 using antimiR-195 resulted in an increase of CYP27B1 mRNA by 1.6-fold [PMC4668367]. These findings indicate that while hsa-mir-195 has potential anti-cancer effects, its therapeutic efficacy may be compromised by cellular mechanisms that excrete or otherwise neutralize it [PMC5706292]. Therefore, any therapeutic strategies involving hsa-mir-195 should account for the possibility that cancer cells may evade its effects by actively removing it from the cell [PMC5706292].
a u g cU -A ca gaa gcu cccug cu AGCAGCACAG AAUAUUGGCA gg g ||| ||||| || |||||||||| |||||||||| || ugg gggac gA UCGUCGUGUC UUAUAACCgu cu c g u g CC GG -- gag
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000461 |
| Description | Homo sapiens hsa-miR-195-5p mature miRNA |
| Sequence | 15 - UAGCAGCACAGAAAUAUUGGCA - 36 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004615 |
| Description | Homo sapiens hsa-miR-195-3p mature miRNA |
| Sequence | 53 - CCAAUAUUGGCUGUGCUGCUCCA - 75 |
| Evidence |
experimental
cloned [2] |
|