MIR195 is a subset of miRNAs that has been studied in relation to its expression in MIN6B1 cells and rat pancreatic islets. Agarose gel electrophoresis was conducted at different N/P ratios to confirm the condensation of MIR195 with FasudilSHPMIR195 [PMC4990390]. The expression of MIR195, along with other miRNAs such as miR34a, miR96, miR145, miR146, and miR210, was further analyzed using quantitative RT-PCR in a large series of samples obtained from MIN6B1 cells and freshly isolated rat pancreatic islets [PMC2551683]. References: - [PMC4990390]: The reference provides information on the agarose gel electrophoresis conducted at different N/P ratios to confirm the condensation of MIR195 with FasudilSHPMIR195. - [PMC2551683]: The reference provides information on the analysis of the expression of MIR195 and other miRNAs using quantitative RT-PCR in samples obtained from MIN6B1 cells and rat pancreatic islets.
a u g cU -A ca gaa gcu cccug cu AGCAGCACAG AAUAUUGGCa gg g ||| ||||| || |||||||||| |||||||||| || ugg gggac ga UCGUCGUGUC UUAUAACCgu cu c g u g CC GG -- gag
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000461 |
Description | Homo sapiens hsa-miR-195-5p mature miRNA |
Sequence | 15 - UAGCAGCACAGAAAUAUUGGC - 35 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0004615 |
Description | Homo sapiens hsa-miR-195-3p mature miRNA |
Sequence | 53 - CCAAUAUUGGCUGUGCUGCUCC - 74 |
Evidence |
experimental
cloned [2] |
|