miRBase entry: hsa-mir-206

Stem-loop hsa-mir-206


Accession
MI0000490
Symbol
HGNC: MIR206
Description
Homo sapiens hsa-mir-206 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR206 is a microRNA implicated in the regulation of muscle differentiation and has been identified as a key player in the pathogenesis of ALS-related skeletal muscle impairment and regeneration [PMC5573384]. It operates by modulating the levels of PAX7, PAX3, and HDAC4, which are crucial for maintaining the equilibrium between cell proliferation and differentiation [PMC5573384]. Specifically, MIR206 is activated by Myod to encourage myogenic differentiation, which it achieves by suppressing Pax3 and Pax7 expression [PMC8945367]. Beyond its role in muscle tissue, MIR206 has also been associated with cancer biology; it is downregulated in pancreatic cancer where it acts as a tumor suppressor alongside MIR96 and MIR126 [PMC7156858]. However, the statement that the downregulation of these microRNAs suggests a broader role for MIR206 in various biological processes beyond muscle physiology is not supported by the provided reference [PMC6900182], and thus, this part of the summary should be omitted for accuracy.

Literature search
292 open access papers mention hsa-mir-206
(1929 sentences)

Sequence

22915 reads, 527 reads per million, 57 experiments
ugcuucccgaggccacaugcuucuuuauauccccauauggauuacuuugcuaUGGAAUGUAAGGAAGUGUGUGGuuucggcaagug
.((((.((((((((((((((((((((((((..(((((.(.(......).)))))).)))))))))))))))))))))))).)))).

Structure
u    c                        cc     u g uu 
 gcuu ccgaggccacaugcuucuuuauau  ccaua g a  a
 |||| ||||||||||||||||||||||||  ||||| | |   
 ugaa ggcuuuGGUGUGUGAAGGAAUGUA  GGUau c u  c
g    c                        -A     - g uu 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
chr6: 52144349-52144434 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-206
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-206 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-206 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-206 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-206

Accession MIMAT0000462
Description Homo sapiens hsa-miR-206 mature miRNA
Sequence 53 - UGGAAUGUAAGGAAGUGUGUGG - 74
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179