miRBase entry: hsa-mir-206

Stem-loop hsa-mir-206


Accession
MI0000490
Symbol
HGNC: MIR206
Description
Homo sapiens hsa-mir-206 precursor miRNA
Gene family
MIPF0000038; mir-1

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR206, a type of microRNA, plays a crucial role in the pathogenesis of ALS skeletal muscle impairment and regeneration by regulating the levels of PAX7, PAX3, and HDAC4, thereby affecting the balance between cell proliferation and differentiation [PMC5573384]. Myod can directly activate MIR206 to promote myogenic differentiation by inhibiting Pax3 and Pax7 [PMC8945367]. Additionally, MIR206 has been found to be downregulated in pancreatic cancer and functions as a tumor suppressor along with MIR96 and MIR126 [PMC7156858]. Furthermore, MIR206 or miR126 has been implicated in other studies as well [PMC6900182].

MIR206 is a type of microRNA that is involved in various biological processes. In the context of ALS skeletal muscle impairment and regeneration, it has been found to regulate the levels of PAX7, PAX3, and HDAC4. This regulation affects the balance between cell proliferation and differentiation [PMC5573384].

Myod is able to directly activate MIR206. This activation promotes myogenic differentiation by inhibiting Pax3 and Pax7 [PMC8945367].

In pancreatic cancer, MIR206 along with MIR96 and MIR126 are downregulated. These microRNAs function as tumor suppressors in this context [PMC7156858].

MIR206 or miR126 have also been implicated in other studies for their potential roles in various biological processes [PMC6900182].

Literature search
292 open access papers mention hsa-mir-206
(1929 sentences)

Sequence

22915 reads, 1819 reads per million, 57 experiments
ugcuucccgaggccacaugcuucuuuauauccccauauggauuacuuugcuaUGGAAUGUAAGGAAGUGUGUGGuuucggcaagug
.((((.((((((((((((((((((((((((..(((((.(.(......).)))))).)))))))))))))))))))))))).)))).

Structure
u    c                        cc     u g uu 
 gcuu ccgaggccacaugcuucuuuauau  ccaua g a  a
 |||| ||||||||||||||||||||||||  ||||| | |   
 ugaa ggcuuuGGUGUGUGAAGGAAUGUA  GGUau c u  c
g    c                        -A     - g uu 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
chr6: 52144349-52144434 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-206
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-206 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-206 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-206 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-206

Accession MIMAT0000462
Description Homo sapiens hsa-miR-206 mature miRNA
Sequence 53 - UGGAAUGUAAGGAAGUGUGUGG - 74
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179