WARNING: This summary was generated by AI. MIR206 is a microRNA implicated in the regulation of muscle differentiation and has been identified as a key player in the pathogenesis of ALS-related skeletal muscle impairment and regeneration [PMC5573384]. It operates by modulating the levels of PAX7, PAX3, and HDAC4, which are crucial for maintaining the equilibrium between cell proliferation and differentiation [PMC5573384]. Specifically, MIR206 is activated by Myod to encourage myogenic differentiation, which it achieves by suppressing Pax3 and Pax7 expression [PMC8945367]. Beyond its role in muscle tissue, MIR206 has also been associated with cancer biology; it is downregulated in pancreatic cancer where it acts as a tumor suppressor alongside MIR96 and MIR126 [PMC7156858]. However, the statement that the downregulation of these microRNAs suggests a broader role for MIR206 in various biological processes beyond muscle physiology is not supported by the provided reference [PMC6900182], and thus, this part of the summary should be omitted for accuracy.
u c cc u g uu gcuu ccgaggccacaugcuucuuuauau ccaua g a a |||| |||||||||||||||||||||||| ||||| | | ugaa ggcuuuGGUGUGUGAAGGAAUGUA GGUau c u c g c -A - g uu
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000462 |
| Description | Homo sapiens hsa-miR-206-3p mature miRNA |
| Sequence | 53 - UGGAAUGUAAGGAAGUGUGUGG - 74 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|