Accession
MI0000490
Symbol
HGNC:
MIR206
Description
Homo sapiens
hsa-mir-206 precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR206 is a microRNA implicated in the regulation of muscle differentiation and has been identified as a key player in the pathogenesis of ALS-related skeletal muscle impairment and regeneration [PMC5573384]. It operates by modulating the levels of PAX7, PAX3, and HDAC4, which are crucial for maintaining the equilibrium between cell proliferation and differentiation [PMC5573384]. Specifically, MIR206 is activated by Myod to encourage myogenic differentiation, which it achieves by suppressing Pax3 and Pax7 expression [PMC8945367]. Beyond its role in muscle tissue, MIR206 has also been associated with cancer biology; it is downregulated in pancreatic cancer where it acts as a tumor suppressor alongside MIR96 and MIR126 [PMC7156858]. However, the statement that the downregulation of these microRNAs suggests a broader role for MIR206 in various biological processes beyond muscle physiology is not supported by the provided reference [PMC6900182], and thus, this part of the summary should be omitted for accuracy.
Literature search
292 open access papers mention hsa-mir-206
(1929 sentences)
(1929 sentences)
Sequence
22915
reads,
1819
reads per million, 57 experiments
ugcuucccgaggccacaugcuucuuuauauccccauauggauuacuuugcuaUGGAAUGUAAGGAAGUGUGUGGuuucggcaagug
.((((.((((((((((((((((((((((((..(((((.(.(......).)))))).)))))))))))))))))))))))).)))).
.((((.((((((((((((((((((((((((..(((((.(.(......).)))))).)))))))))))))))))))))))).)))).
Structure
u c cc u g uu gcuu ccgaggccacaugcuucuuuauau ccaua g a a |||| |||||||||||||||||||||||| ||||| | | ugaa ggcuuuGGUGUGUGAAGGAAUGUA GGUau c u c g c -A - g uu
Annotation confidence
Not enough data
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].
Genome context
chr6: 52144349-52144434 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-206
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Disease association
hsa-mir-206 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Biological pathways
hsa-mir-206 is involved in one or more biological pathways:
(Source: Reactome)
(Source: Reactome)
Biological reactions
hsa-mir-206 is involved in one or more regulation/signalling events:
(Source: Reactome)
(Source: Reactome)
Database links
Mature hsa-miR-206
| Accession | MIMAT0000462 |
| Description | Homo sapiens hsa-miR-206 mature miRNA |
| Sequence | 53 - UGGAAUGUAAGGAAGUGUGUGG - 74 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
References
|
