miRBase entry: cbr-mir-80

Stem-loop cbr-mir-80


Accession
MI0000518
Description
Caenorhabditis briggsae cbr-mir-80 precursor miRNA

Literature search
1 open access papers mention cbr-mir-80
(1 sentences)

Sequence


uggacacucuuucgcucagcuuucgacaugauucuaaacaauacgcugucgcaauguuguUGAGAUCAUUAGUUGAAAGCCGAacgauucgagauaucca
((((..(((..(((.((.((((((((((((((.((.(((((((.((....))..))))))).)))))))..))))))))).)).)))...)))...))))

Structure
    -ca   -uu   c  a         --     u  a       -c  u 
ugga   cuc   ucg uc gcuuucgac  augau cu aacaaua  gc g
||||   |||   ||| || |||||||||  ||||| || |||||||  ||  
accu   gag   agc AG CGAAAGUUG  UACUA GA Uuguugu  cg u
    aua   cuu   a  C         AU     -  G       aa  c 


Annotation confidence Low
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1,2]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
chrIII: 14440871-14440970 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from cbr-mir-80
Name Accession Chromosome Start End Strand Confidence




Database links

Mature cbr-miR-80

Accession MIMAT0000487
Description Caenorhabditis briggsae cbr-miR-80 mature miRNA
Sequence 61 - UGAGAUCAUUAGUUGAAAGCCGA - 83
Evidence not_experimental

References

  1. PubMed ID: 11679671
    An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans
    "Lau NC, Lim LP, Weinstein EG, Bartel DP"
    "Science (2001) 294:858-862

  2. PubMed ID: 11679672
    An extensive class of small RNAs in Caenorhabditis elegans
    "Lee RC, Ambros V"
    "Science (2001) 294:862-864