miRBase entry: mmu-mir-29c

Stem-loop mmu-mir-29c


Accession
MI0000577
Symbol
MGI: Mir29c
Description
Mus musculus mmu-mir-29c precursor miRNA

Literature search
291 open access papers mention mmu-mir-29c
(2500 sentences)

Sequence

137899 reads, 875 reads per million, 107 experiments
aucucuuacacaggcUGACCGAUUUCUCCUGGUGUUCagagucuguuuuugucUAGCACCAUUUGAAAUCGGUUAugauguaggggga
..((((((((((...(((((((((((...(((((((.(((...........))))))))))...))))))))))))).))))))))..

Structure
au        -  ggc           UCC       C   gucu 
  cucuuaca ca   UGACCGAUUUC   UGGUGUU aga    g
  |||||||| ||   |||||||||||   ||||||| |||    u
  ggggaugu gu   AUUGGCUAAAG   ACCACGA Ucu    u
ag        a  ---           UUU       -   guuu 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr1: 195037547-195037634 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-29c
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-29c-5p

Accession MIMAT0004632
Description Mus musculus mmu-miR-29c-5p mature miRNA
Sequence 16 - UGACCGAUUUCUCCUGGUGUUC - 37
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-29c-3p

Accession MIMAT0000536
Description Mus musculus mmu-miR-29c-3p mature miRNA
Sequence 54 - UAGCACCAUUUGAAAUCGGUUA - 75
Evidence experimental
cloned [1-3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009