miRBase entry: rno-mir-323

Stem-loop rno-mir-323


Accession
MI0000591
Description
Rattus norvegicus rno-mir-323 precursor miRNA

Literature search
7 open access papers mention rno-mir-323
(19 sentences)

Sequence

60442 reads, 1700 reads per million, 357 experiments
uugguacuuggagagAGGUGGUCCGUGGCGCGUUCGCuucauuuauggcgCACAUUACACGGUCGACCUCUuugcgguaucuaauc
..((((((.(.((((((((.(.(((((..(.((.((((........)))).)).)..))))).).)))))))).))))))).....

Structure
---uu      u g        G U     GC C  U    uca 
     gguacu g agagAGGU G CCGUG  G GU CGCu   u
     |||||| | |||||||| | |||||  | || ||||    
     cuaugg c uuUCUCCA C GGCAC  U CA gcgg   u
cuaau      - g        G U     AU A  C    uau 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr6: 133861199-133861284 [+]
Clustered miRNAs
15 other miRNAs are < 10 kb from rno-mir-323
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-323-5p

Accession MIMAT0004637
Description Rattus norvegicus rno-miR-323-5p mature miRNA
Sequence 16 - AGGUGGUCCGUGGCGCGUUCGC - 37
Evidence experimental
cloned [3], SOLiD [4]

Mature rno-miR-323-3p

Accession MIMAT0000550
Description Rattus norvegicus rno-miR-323-3p mature miRNA
Sequence 51 - CACAUUACACGGUCGACCUCU - 71
Evidence experimental
cloned [1-3], Northern [1], SOLiD [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  4. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68