miRBase entry: mmu-mir-324

Stem-loop mmu-mir-324


Accession
MI0000595
Symbol
MGI: Mir324
Description
Mus musculus mmu-mir-324 precursor miRNA
Gene family
MIPF0000165; mir-324

Literature search
25 open access papers mention mmu-mir-324
(78 sentences)

Sequence

27959 reads, 383 reads per million, 106 experiments
aacugacuaugccuccuCGCAUCCCCUAGGGCAUUGGUGUaaagcuggagacCCACUGCCCCAGGUGCUGCUggggguuguagucugac
....((((((((((((..(((.(.(((.(((((.(((.((..........))))).))))).))).).))).))))).)))))))....

Structure
aacu       -     uC   U C   A     U   U  aaag 
    gacuaug ccucc  GCA C CCU GGGCA UGG GU    c
    ||||||| |||||  ||| | ||| ||||| ||| ||     
    cugaugu ggggg  CGU G GGA CCCGU ACC ca    u
cagu       u     -U   C U   C     C   -  gagg 


Annotation confidence High
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000594) - expression of miRNAs from both arms was later independently verified in mouse [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The predominant miR-324-3p clone has a 3' terminal U residue, which is incompatible with the genome sequence [3].

Genome context
chr11: 70012043-70012131 [+]

Database links

Mature mmu-miR-324-5p

Accession MIMAT0000555
Description Mus musculus mmu-miR-324-5p mature miRNA
Sequence 18 - CGCAUCCCCUAGGGCAUUGGUGU - 40
Evidence experimental
cloned [2-3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-324-3p

Accession MIMAT0000556
Description Mus musculus mmu-miR-324-3p mature miRNA
Sequence 53 - CCACUGCCCCAGGUGCUGCU - 72
Evidence experimental
cloned [2], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365