Stem-loop rno-mir-341

Accession

MI0000624

Description

Rattus norvegicus rno-mir-341 precursor miRNA

Literature search

4 open access papers mention rno-mir-341
(7 sentences)

Sequence

466634 reads, 526 reads per million, 455 experiments

aaaaugaugaugucaguuggccggucggccgaucgcucggucugucagucagucggUCGGUCGAUCGGUCGGUCGGUcagucggcuuccugucuuc
.....(((((.(((.((((((((((((((((((((.((((.(((.(.....).))))))).)))))))))))))))))))).))).))..)))...

Structure

aaaau   --  u   a                    c    u   u a 
     gau  ga guc guuggccggucggccgaucg ucgg cug c g
     |||  || ||| |||||||||||||||||||| |||| ||| | u
     cug  cu cgg ugacUGGCUGGCUGGCUAGC GGCU ggc g c
--cuu   uc  u   c                    U    -   u a 

Annotation confidence Not enough data

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

chr6: 133733240-133733335 [+]

Clustered miRNAs

2 other miRNAs are < 10 kb from rno-mir-341

Mature rno-miR-341

• Accession: MIMAT0000587
• Description: Rattus norvegicus rno-miR-341 mature miRNA
• Sequence: 57 - UCGGUCGAUCGGUCGGUCGGU - 77
• Evidence: experimental ; cloned [1-2], SOLiD [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


3. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249