miRBase entry: rno-mir-341

Stem-loop rno-mir-341


Accession
MI0000624
Description
Rattus norvegicus rno-mir-341 precursor miRNA

Literature search
4 open access papers mention rno-mir-341
(7 sentences)

Sequence

466633 reads, 526 reads per million, 454 experiments
aaaaugaugaugucaguuggccggucggccgaucgcucggucugucagucagucggUCGGUCGAUCGGUCGGUCGGUcagucggcuuccugucuuc
.....(((((.(((.((((((((((((((((((((.((((.(((.(.....).))))))).)))))))))))))))))))).))).))..)))...

Structure
aaaau   --  u   a                    c    u   u a 
     gau  ga guc guuggccggucggccgaucg ucgg cug c g
     |||  || ||| |||||||||||||||||||| |||| ||| | u
     cug  cu cgg ugacUGGCUGGCUGGCUAGC GGCU ggc g c
--cuu   uc  u   c                    U    -   u a 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr6: 133733240-133733335 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from rno-mir-341
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-341

Accession MIMAT0000587
Description Rattus norvegicus rno-miR-341 mature miRNA
Sequence 57 - UCGGUCGAUCGGUCGGUCGGU - 77
Evidence experimental
cloned [1-2], SOLiD [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249