miRBase entry: mmu-mir-342

Stem-loop mmu-mir-342


Accession
MI0000627
Symbol
MGI: Mir342
Description
Mus musculus mmu-mir-342 precursor miRNA mir-342
Gene
family?
RF00760; mir-342

Literature search
50 open access papers mention mmu-mir-342
(394 sentences)

Sequence

180785 reads, 721 reads per million, 107 experiments
gaaaaugggcucaaggugAGGGGUGCUAUCUGUGAUUGAGggacauggucaauggaauugUCUCACACAGAAAUCGCACCCGUcaccuuggccugcuga
......((((.((((((((.((((((..((((((..(((((.((((.....)))....).)))))))))))....)))))).)))))))))))).....

Structure
gaaaau    u        G      --UA      AU     g ----   g 
      gggc caaggugA GGGUGC    UCUGUG  UGAGg a    cau g
      |||| |||||||| ||||||    ||||||  ||||| |    ||| u
      uccg guuccacU CCCACG    AGACAC  ACUCU u    gua c
-agucg    -        G      CUAA      --     g uaag   a 


Annotation confidence High
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000626). Seitz et al. independently predicted the miRNA hairpin precursor sequence by conservation between mouse and human [2]. Landgraf et al. later cloned and sequenced mature products from both arms of the predicted hairpin [3]. The mature sequences shown here represent the most commonly cloned forms from large-scale cloning studies [3].

Genome context
chr12: 108658620-108658718 [+]

Database links

Mature mmu-miR-342-5p

Accession MIMAT0004653
Description Mus musculus mmu-miR-342-5p mature miRNA
Sequence 19 - AGGGGUGCUAUCUGUGAUUGAG - 40
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-342-3p

Accession MIMAT0000590
Description Mus musculus mmu-miR-342-3p mature miRNA
Sequence 61 - UCUCACACAGAAAUCGCACCCGU - 83
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 15310658
    A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
    "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
    "Genome Res (2004) 14:1741-1748

  5. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365