Stem-loop mmu-mir-345

Accession

MI0000632

Symbol

MGI: Mir345

Description

Mus musculus mmu-mir-345 precursor miRNA mir-345

Gene
family

RF01044; mir-345

Literature search

13 open access papers mention mmu-mir-345
(25 sentences)

Sequence

113284 reads, 877 reads per million, 104 experiments

acccaaguccaggccuGCUGACCCCUAGUCCAGUGCUUgugguggcuacugggcCCUGAACUAGGGGUCUGGAGACcuggguuugaucuccacagg
...((((((((((.((.(.((((((((((.(((.((((((((...)))).)))).))).)))))))))).).)).))))))))))...........

Structure

--------acc          c  G U          C   U    -    u 
           caaguccagg cu C GACCCCUAGU CAG GCUU gugg  
           |||||||||| || | |||||||||| ||| |||| |||| g
           guuugggucC GA G CUGGGGAUCA GUC cggg cauc  
ggacaccucua          A  G U          A   C    u    g 

Annotation confidence High

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA was predicted based on homology to the verified rat sequence (MIR:MI0000631). Seitz et al. independently predicted the miRNA hairpin precursor sequence by conservation between mouse and human [2]. Landgraf et al. later verified mature miRNA expression from both arms of the hairpin precursor [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

chr12: 108836973-108837068 [+]

Mature mmu-miR-345-5p

• Accession: MIMAT0000595
• Description: Mus musculus mmu-miR-345-5p mature miRNA
• Sequence: 17 - GCUGACCCCUAGUCCAGUGCUU - 38
• Evidence: experimental ; cloned [3], Illumina [4-5]

Mature mmu-miR-345-3p

• Accession: MIMAT0004656
• Description: Mus musculus mmu-miR-345-3p mature miRNA
• Sequence: 55 - CCUGAACUAGGGGUCUGGAGAC - 76
• Evidence: experimental ; cloned [3], Illumina [4-5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 15310658
   A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
   "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
   "Genome Res (2004) 14:1741-1748


5. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365