miRBase entry: rno-mir-346

Stem-loop rno-mir-346


Accession
MI0000633
Description
Rattus norvegicus rno-mir-346 precursor miRNA

Literature search
6 open access papers mention rno-mir-346
(10 sentences)

Sequence

15004 reads, 24 reads per million, 214 experiments
ucuguguugggcaucUGUCUGCCUGAGUGCCUGCCUCUcuguugcucugaaggaggcaggggcugggccugcagcugccugggcagagcugcuccuuc
(((((..((((((.((((..((((.(((.((((((((.((..........)))))))))).)))))))..)))).)))))).)))))...........

Structure
-----------     gu      u    CU    G   G        U  guug 
           ucugu  ugggca cUGU  GCCU AGU CCUGCCUC cu    c
           |||||  |||||| ||||  |||| ||| |||||||| ||     
           agacg  guccgu gacg  cggg ucg ggacggag ga    u
cuuccucgucg     -g      c    uc    -   g        -  aguc 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The sequence reported in [1] contains two 3' terminal A residues, which conflict with the precursor sequence shown here.

Genome context
chr16: 11250054-11250151 [+]

Database links

Mature rno-miR-346

Accession MIMAT0000596
Description Rattus norvegicus rno-miR-346 mature miRNA
Sequence 16 - UGUCUGCCUGAGUGCCUGCCUCU - 38
Evidence experimental
cloned [1-2], SOLiD [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249