Stem-loop rno-mir-129-2

Accession

MI0000637

Description

Rattus norvegicus rno-mir-129-2 precursor miRNA

Literature search

27 open access papers mention rno-mir-129-2
(185 sentences)

Sequence

266214 reads, 370 reads per million, 417 experiments

agacugcccuucgcgaauCUUUUUGCGGUCUGGGCUUGCuguacauaacucaauagccggAAGCCCUUACCCCAAAAAGCAUucgcggagggcgcgc
....(((((((((((((((((((((.(((..(((((((((((..........)))))...))))))..))).))))))).))))))))))))))...

Structure

agac              -       C   CU      ---     acau 
    ugcccuucgcgaau CUUUUUG GGU  GGGCUU   GCugu    a
    |||||||||||||| ||||||| |||  ||||||   |||||     
    gcgggaggcgcuUA GAAAAAC CCA  CCCGAA   cgaua    a
-cgc              C       C   UU      ggc     acuc 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. Kim et al [1] and He et al [4] both identify the mature product from the 3' arm, named miR-129* here.

Genome context

chr3: 83137297-83137393 [-]

Mature rno-miR-129-5p

• Accession: MIMAT0000600
• Description: Rattus norvegicus rno-miR-129-5p mature miRNA
• Sequence: 19 - CUUUUUGCGGUCUGGGCUUGC - 39
• Evidence: experimental ; cloned [1-2], SOLiD [3]

Mature rno-miR-129-2-3p

• Accession: MIMAT0000601
• Description: Rattus norvegicus rno-miR-129-2-3p mature miRNA
• Sequence: 61 - AAGCCCUUACCCCAAAAAGCAU - 82
• Evidence: experimental ; cloned [1,3-4], Northern [1], SOLiD [5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


3. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249


4. PubMed ID: 15345052
   Microarray analysis of microRNA expression in the developing mammalian brain
   Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
   Genome Biol (2004) 5:R68


5. PubMed ID: 17805466
   Cloning and identification of novel microRNAs from rat hippocampus
   "He X, Zhang Q, Liu Y, Pan X"
   "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714