miRBase entry: rno-mir-7a-1

Stem-loop rno-mir-7a-1


Accession
MI0000641
Description
Rattus norvegicus rno-mir-7a-1 precursor miRNA

Literature search
43 open access papers mention rno-mir-7a-1
(248 sentences)

Sequence

52275 reads, 93 reads per million, 481 experiments
uguuggccuaguucugugUGGAAGACUAGUGAUUUUGUUGUuuuuagauaacuaagacgACAACAAAUCACAGUCUGCCAUauggcacaggccaccu
...((((((.((.((((((((.(((((.(((((((.(((((((((((....)))))..)))))))))))))))))).)))))))).))))))))...

Structure
ugu      a  u        A     A       U      --     a 
   uggccu gu cugugUGG AGACU GUGAUUU GUUGUu  uuuag u
   |||||| || |||||||| ||||| ||||||| ||||||  |||||  
   accgga ca gguaUACC UCUGA CACUAAA CAACAg  gaauc a
ucc      -  c        G     -       -      ca     a 


Annotation confidence High
Do you think this miRNA is real?
Comments
Landgraf et al. show that the 5' product is the predominant one [3]. The 3' product is renamed miR-7a*. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr17: 6675016-6675112 [+]

Database links

Mature rno-miR-7a-1-3p

Accession MIMAT0000607
Description Rattus norvegicus rno-miR-7a-1-3p mature miRNA
Sequence 60 - ACAACAAAUCACAGUCUGCCAU - 81
Evidence experimental
cloned [1,3], Northern [1], SOLiD [4]

Mature rno-miR-7a-5p

Accession MIMAT0000606
Description Rattus norvegicus rno-miR-7a-5p mature miRNA
Sequence 19 - UGGAAGACUAGUGAUUUUGUUGU - 41
Evidence experimental
cloned [1-2], SOLiD [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  4. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68