Stem-loop mmu-mir-124-1

Accession

MI0000716

Symbol

MGI: Mir124a-1

Description

Mus musculus mmu-mir-124-1 precursor miRNA

Literature search

229 open access papers mention mmu-mir-124-1
(2631 sentences)

Sequence

889072 reads, 6475 reads per million, 75 experiments

aggccucucucucCGUGUUCACAGCGGACCUUGAUuuaaauguccauacaauUAAGGCACGCGGUGAAUGCCaagaauggggcug
.((((((..(((..((((((((.(((..((((((((.............))))))))..))).))))))))..)))..)))))).

Structure

a      uc   cC        A   GA        uaaau 
 ggccuc  ucu  GUGUUCAC GCG  CCUUGAUu     g
 ||||||  |||  |||||||| |||  ||||||||     u
 ucgggg  aga  CGUAAGUG CGC  GGAAUuaa     c
g      ua   aC        G   AC        cauac 

Annotation confidence High

Comments

miR-124 was cloned from mouse brain [1] and embryonic stem cells [2] by independent groups. There are 3 predicted precursor hairpin sequences: mir-124-1 (MIR:MI0000716) on chromosome 14, mir-124-2 (MIR:MI0000717) on chromosome 3, and mir-124-3 (previously known as miR-124 here, MIR:MI0000150) on chromosome 2. All have closely related predicted human homologues (MIR:MI0000443, MIR:MI0000444 and MIR:MI0000445). Lagos-Quintana et al. also report a mature miRNA sequence miR-124b, with a G insertion at position 12 [1]. miR-124b is not found in either the mouse or human genome assemblies.

Genome context

chr14: 64590657-64590741 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from mmu-mir-124-1

Mature mmu-miR-124-5p

• Accession: MIMAT0004527
• Description: Mus musculus mmu-miR-124-5p mature miRNA
• Sequence: 14 - CGUGUUCACAGCGGACCUUGAU - 35
• Evidence: experimental ; cloned [4], Illumina [5-6]

Mature mmu-miR-124-3p

• Accession: MIMAT0000134
• Description: Mus musculus mmu-miR-124-3p mature miRNA
• Sequence: 53 - UAAGGCACGCGGUGAAUGCC - 72
• Evidence: experimental ; cloned [1-4], Illumina [5-6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12919684
   Embryonic stem cell-specific MicroRNAs
   "Houbaviy HB, Murray MF, Sharp PA"
   "Dev Cell (2003) 5:351-358


3. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


4. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


5. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


6. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009