miRBase entry: mmu-mir-9-3

Stem-loop mmu-mir-9-3


Accession
MI0000721
Symbol
MGI: Mir9-3
Description
Mus musculus mmu-mir-9-3 precursor miRNA

Literature search
208 open access papers mention mmu-mir-9-3
(1087 sentences)

Sequence

3449366 reads, 7672 reads per million, 103 experiments
ggaggcccguuucucUCUUUGGUUAUCUAGCUGUAUGAgugccacagagccgucAUAAAGCUAGAUAACCGAAAGUagaaaugacucuca
.((((..(((((((((.(((((((((((((((.(((((..((......))..))))).))))))))))))))))).)))))))..)))).

Structure
g    cc       -  C               G     gu  ca 
 gagg  cguuucu cU UUUGGUUAUCUAGCU UAUGA  gc  c
 ||||  ||||||| || ||||||||||||||| |||||  ||   
 cucu  guaaaga GA AAGCCAAUAGAUCGA AUAcu  cg  a
a    ca       U  -               A     gc  ag 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr7: 79505264-79505353 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-9-3
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-9-5p

Accession MIMAT0000142
Description Mus musculus mmu-miR-9-5p mature miRNA
Sequence 16 - UCUUUGGUUAUCUAGCUGUAUGA - 38
Evidence experimental
cloned [1-2,4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-9-3p

Accession MIMAT0000143
Description Mus musculus mmu-miR-9-3p mature miRNA
Sequence 55 - AUAAAGCUAGAUAACCGAAAGU - 76
Evidence experimental
cloned [1,4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73