Stem-loop mmu-mir-138-1

Accession

MI0000722

Symbol

MGI: Mir138-1

Description

Mus musculus mmu-mir-138-1 precursor miRNA mir-138

Gene
family

RF00671; mir-138

Literature search

94 open access papers mention mmu-mir-138-1
(747 sentences)

Sequence

407566 reads, 1194 reads per million, 103 experiments

cucuagcaugguguugugggacAGCUGGUGUUGUGAAUCAGGCCGuugccaaucagagaaCGGCUACUUCACAACACCAGGGccacacugcacugcaag
.....(((..((((.(((((....(((((((((((((...(((((((..(.....)..)))))))..)))))))))))))..)).))).)))))))...

Structure

cucua   ug    u   -  acAG             UCA       gc a 
     gca  gugu gug gg    CUGGUGUUGUGAA   GGCCGuu  c a
     |||  |||| ||| ||    |||||||||||||   |||||||  | u
     cgu  cacg cac cc    GACCACAACACUU   UCGGCaa  g c
--gaa   --    u   a  --GG             -CA       ga a 

Annotation confidence High

Comments

Mouse miR-138 was cloned from mouse brain tissue in [1]. There are 2 predicted hairpin precursor structures in the mouse genome, each has a closely related human homologue [2]. mir-138-1 (MIR:MI0000722) is found on mouse chromosome 8, and mir-138-2 (MIR:MI0000164, previously named mir-138 here) on chromosome 9. Kim et al. and Obernosterer et al. independently show that the mature product is a 23mer [3,4].

Genome context

chr9: 122682876-122682974 [+]

Mature mmu-miR-138-5p

• Accession: MIMAT0000150
• Description: Mus musculus mmu-miR-138-5p mature miRNA
• Sequence: 23 - AGCUGGUGUUGUGAAUCAGGCCG - 45
• Evidence: experimental ; cloned [1,5], Illumina [6-7]

Mature mmu-miR-138-1-3p

• Accession: MIMAT0004668
• Description: Mus musculus mmu-miR-138-1-3p mature miRNA
• Sequence: 61 - CGGCUACUUCACAACACCAGGG - 82
• Evidence: experimental ; cloned [5], Illumina [6-7]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


3. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


4. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


5. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73


6. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


7. PubMed ID: 16738409
   Post-transcriptional regulation of microRNA expression
   "Obernosterer G, Leuschner PJ, Alenius M, Martinez J"
   "RNA (2006) 12:1161-1167