MIR128-2 is a microRNA gene implicated in various cellular processes, including apoptosis and drug resistance in cancer [PMC3566410]. It is co-expressed with its host gene ARPP21, and mutant TP53 has been shown to upregulate both MIR128-2 and ARPP21, suggesting a regulatory interaction [PMC4302087]. A specific A13G mutation in MIR128-2 disrupts the processing of its primary transcript, leading to reduced apoptosis and increased resistance to dexamethasone in t(4;11) ALL cells [PMC9406077]. Additionally, the R175H mutant TP53 variant upregulates MIR128-2 expression, which then targets E2F5 to enhance p21 expression, inhibiting apoptosis and conferring resistance to several chemotherapeutic agents [PMC7749743]. MIR128-2 has been identified as an oncogenic microRNA with prognostic value for gastrointestinal integrity (GI) and is part of a three-miRNA signature (miGISig) predictive of GI-related clinical outcomes [PMC7802300]. It shares the mature miR-128 sequence with MIR128-1 but has distinct regulatory roles across different cancer types [PMC7802300]. The expression of MIR128-2 relative to its host gene ARPP21 remains an area for further investigation due to the presence of a Pol III promoter in its 5′ flanking region [PMC5346679].
ugu a AUA AC g gag gcaguggg agGGGGGCCG CACUGU GAGA u u |||||||| |||||||||| |||||| |||| | ugucaucc UUUCUCUGGC GUGACA CUcu g a cug c CAA -- g acg
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000424 |
| Description | Homo sapiens hsa-miR-128-3p mature miRNA |
| Sequence | 52 - UCACAGUGAACCGGUCUCUUU - 72 |
| Evidence |
experimental
cloned [3], Illumina [4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0031095 |
| Description | Homo sapiens hsa-miR-128-2-5p mature miRNA |
| Sequence | 15 - GGGGGCCGAUACACUGUACGAGA - 37 |
| Evidence |
experimental
Illumina [4] |
|