MIR302A is a microRNA involved in various cellular processes, including the regulation of inflammation, oxidative stress, and cell proliferation [PMC7576609; PMC8685359; PMC9889149].. It is part of the miR-302/367 cluster, which is highly expressed in embryonic stem cells and plays a role in stem cell formation and differentiation [PMC6722449]. MIR302A expression has been associated with the regulation of genes involved in cancer progression and has potential as a biomarker for tumor characteristics in colorectal cancer [PMC7602903]. It can also regulate gene expression by directly binding to target mRNA sequences, as demonstrated with ZFP91-3′UTR in luciferase reporter assays [PMC8365611]. Dysregulation of MIR302A has been implicated in various diseases including cancer, where it can act as both an oncogene and tumor suppressor gene [PMC4430936; PMC4761210].'>PMC4761210].. Moreover, MIR302A expression is modulated during cellular differentiation processes such as adipogenesis and osteogenesis [PMC4951121], and it can influence cell viability through signaling pathways like MAPK [PMC8612787]. Research also indicates that MIR302A may be involved in microvesicle-mediated miRNA transfer and NF-κB signaling pathway dysfunction during hepatocarcinogenesis [PMC4761210].
c U U gaa cca cACU AAACGUGGA GUACUUGCUuu a ||| |||| ||||||||| ||||||||||| c ggu GUGG UUUGUACCU CGUGAAUgaag u A U U aaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0000683 |
Description | Homo sapiens hsa-miR-302a-5p mature miRNA |
Sequence | 6 - ACUUAAACGUGGAUGUACUUGCU - 28 |
Evidence |
experimental
cloned [2,4], Northern [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000684 |
Description | Homo sapiens hsa-miR-302a-3p mature miRNA |
Sequence | 44 - UAAGUGCUUCCAUGUUUUGGUGA - 66 |
Evidence |
experimental
cloned [2,4], Northern [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|