MIR302A is a microRNA that is part of the miR-302 family, which includes MIR302B, MIR302C, and MIR302D [PMC5906557]. It is highly expressed in embryonic stem cells but declines rapidly after differentiation [PMC6722449]. MIR302A has been shown to be involved in various biological processes and diseases. For example, it has been found to be associated with the inhibition of EC migration and proliferation in end-stage renal disease [PMC8685359]. In addition, dysregulation of MIR302A has been implicated in hepatocarcinogenesis and contributes to microvesicle-mediated transfer of miRNAs and dysfunction of the NF-κB signaling pathway [PMC4761210]. Furthermore, MIR302A has been shown to regulate the expression of p65 by binding with ZFP91 directly [PMC8365611]. It has also been found to be related to tumor size and metastasis in colorectal cancer patients [PMC7602903]. Moreover, overexpression of miR-302s (including MIR302A) induces apoptosis in cancer cell lines [PMC4400607]. Overall, MIR302A plays a crucial role in various biological processes and diseases through its regulation of gene expression.
c U U gaa cca cACU AAACGUGGA GUACUUGCUuu a ||| |||| ||||||||| ||||||||||| c ggu GUGG UUUGUACCU CGUGAAUgaag u A U U aaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0000683 |
Description | Homo sapiens hsa-miR-302a-5p mature miRNA |
Sequence | 6 - ACUUAAACGUGGAUGUACUUGCU - 28 |
Evidence |
experimental
cloned [2,4], Northern [2] |
Database links | |
Predicted targets |
Accession | MIMAT0000684 |
Description | Homo sapiens hsa-miR-302a-3p mature miRNA |
Sequence | 44 - UAAGUGCUUCCAUGUUUUGGUGA - 66 |
Evidence |
experimental
cloned [2,4], Northern [2] |
Database links | |
Predicted targets |
|