miRBase entry: hsa-mir-301a

Stem-loop hsa-mir-301a


Accession
MI0000745
Symbol
HGNC: MIR301A
Description
Homo sapiens hsa-mir-301a precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR301A is a microRNA that is regulated by glycine through NMDA receptor-dependent signaling [PMC4880874]. The expression of MIR301A was tested in FXR1-depleted cells to determine if it is regulated by FXR1 [PMC6986764]. In addition to miR128, miR152, miR130a, and MIR301A, other miRNAs such as miR-130b and miR-26b-5p were found to be downregulated in the serum of high-risk women compared to low-risk women and predicted to regulate CSF-1 [PMC6411608]. In some tetrapods and teleosts, MIR301A is located in the first intron of ska2 but is missing in seadragons [PMC9245644]. The role of MIR301A in cancer cell proliferation, migration, invasion, and apoptosis regulation is still under debate [PMC6912041]. IL-6 was found to be overexpressed in serum and CRC tissues and correlated with CRC tumor stage, invasion depth, lymph node metastasis, CEA levels, relapse risk, overall survival (OS), and disease-free survival (DFS) [PMC8040557][PMC6411608][PMC9245644][PMC6912041[PMC6411608][PMC9245644][PMC6912041][PMC6411608][PMC9245644][PMID'>PMC8040557][PMC6411608][PMC9245644][PMC6912041][PMC6411608][PMC9245644][PMID[PMC6411608][PMC9245644][PMC6912041][PMC6411608][PMC9245644][PMID: 10.1002/ijc.33410]. IL-1β was shown to promote colon cancer cell proliferation through the NF-κB pathway by increasing the expression of miR-181a and MIR301A [PMID: 10.1002/ijc.33410] [PMID: 10.1002/ijc.33410] . IL-6 production induced by IL-1β from neutrophils in the intestinal mucosa promoted tumor initiation and progression [PMC8040557][PMC6411608][PMC9245644][PMC6912041]. PNPT1-mediated degradation of MIR301A was found to be blocked by FXR1, and in the absence of FXR1, PNPT1 was recruited to degrade MIR301A-3p [PMC6986764].

Literature search
106 open access papers mention hsa-mir-301a
(566 sentences)

Sequence

71793 reads, 668 reads per million, 133 experiments
acugcuaacgaauGCUCUGACUUUAUUGCACUACUguacuuuacagcuagCAGUGCAAUAGUAUUGUCAAAGCaucugaaagcagg
.(((((..((.(((((.((((.((((((((((.((((........)).)).))))))))))....)))).))))).))..))))).

Structure
a     aa  a     C    ---U          A  -  acu 
 cugcu  cg auGCU UGAC    UUAUUGCACU CU gu   u
 |||||  || ||||| ||||    |||||||||| || ||    
 gacga  gu uaCGA ACUG    GAUAACGUGA ga cg   u
g     aa  c     A    UUAU          C  u  aca 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence is the predicted human homologue of mouse miR-301, cloned from mouse embryonic stem cells [1,3]. Its expression has also been confirmed in human ES cells [2].

Genome context
chr17: 59151136-59151221 [-]

Database links

Mature hsa-miR-301a-3p

Accession MIMAT0000688
Description Homo sapiens hsa-miR-301a-3p mature miRNA
Sequence 51 - CAGUGCAAUAGUAUUGUCAAAGC - 73
Evidence experimental
cloned [2,4], Northern [2]
Database links
Predicted targets

Mature hsa-miR-301a-5p

Accession MIMAT0022696
Description Homo sapiens hsa-miR-301a-5p mature miRNA
Sequence 14 - GCUCUGACUUUAUUGCACUACU - 35
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  4. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73