miRBase entry: hsa-mir-301a

Stem-loop hsa-mir-301a


Accession
MI0000745
Symbol
HGNC: MIR301A
Description
Homo sapiens hsa-mir-301a precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR301A is a microRNA implicated in various cellular processes, including cancer progression [PMC9245644]. It is regulated by glycine through NMDA receptor-dependent signaling, suggesting a complex interaction with neurotransmitter systems [PMC4880874]. Research in oral cancer cell lines indicates that the expression of MIR301A is influenced by the protein FXR1, with MIR301A levels changing upon FXR1 depletion [PMC6986764]. Additionally, MIR301A has been identified as one of several microRNAs that regulate CSF-1, a factor involved in the immune response and potentially in cancer biology [PMC6411608]. In certain species, MIR301A is located within the first intron of the ska2 gene; however, this gene arrangement is absent in seadragons [PMC9245644]. Furthermore, MIR301A has been shown to interact with signaling pathways such as Wnt and NF-κB that are crucial for cancer cell behaviors including proliferation and invasion [PMC6912041]. In colorectal cancer (CRC), IL-1β has been documented to increase the expression of MIR301A in intestinal epithelial cells within colitis-associated cancer patients, which leads to downregulation of BTG anti-proliferation factor 1 (BTG1) expression [PMC8040557]. Lastly, FXR1 appears to protect MIR301A from degradation by PNPT1; without FXR1, PNPT1 can target and degrade MIR301A-3p [PMC6986764].

Literature search
106 open access papers mention hsa-mir-301a
(566 sentences)

Sequence

71793 reads, 262 reads per million, 133 experiments
acugcuaacgaauGCUCUGACUUUAUUGCACUACUguacuuuacagcuagCAGUGCAAUAGUAUUGUCAAAGCaucugaaagcagg
.(((((..((.(((((.((((.((((((((((.((((........)).)).))))))))))....)))).))))).))..))))).

Structure
a     aa  a     C    ---U          A  -  acu 
 cugcu  cg auGCU UGAC    UUAUUGCACU CU gu   u
 |||||  || ||||| ||||    |||||||||| || ||    
 gacga  gu uaCGA ACUG    GAUAACGUGA ga cg   u
g     aa  c     A    UUAU          C  u  aca 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence is the predicted human homologue of mouse miR-301, cloned from mouse embryonic stem cells [1,3]. Its expression has also been confirmed in human ES cells [2].

Genome context
chr17: 59151136-59151221 [-]

Database links

Mature hsa-miR-301a-3p

Accession MIMAT0000688
Description Homo sapiens hsa-miR-301a-3p mature miRNA
Sequence 51 - CAGUGCAAUAGUAUUGUCAAAGC - 73
Evidence experimental
cloned [2,4], Northern [2]
Database links
Predicted targets

Mature hsa-miR-301a-5p

Accession MIMAT0022696
Description Homo sapiens hsa-miR-301a-5p mature miRNA
Sequence 14 - GCUCUGACUUUAUUGCACUACU - 35
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  4. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73