WARNING: This summary was generated by AI. MIR301A is a microRNA implicated in various cellular processes, including cancer progression [PMC9245644]. It is regulated by glycine through NMDA receptor-dependent signaling, suggesting a complex interaction with neurotransmitter systems [PMC4880874]. Research in oral cancer cell lines indicates that the expression of MIR301A is influenced by the protein FXR1, with MIR301A levels changing upon FXR1 depletion [PMC6986764]. Additionally, MIR301A has been identified as one of several microRNAs that regulate CSF-1, a factor involved in the immune response and potentially in cancer biology [PMC6411608]. In certain species, MIR301A is located within the first intron of the ska2 gene; however, this gene arrangement is absent in seadragons [PMC9245644]. Furthermore, MIR301A has been shown to interact with signaling pathways such as Wnt and NF-κB that are crucial for cancer cell behaviors including proliferation and invasion [PMC6912041]. In colorectal cancer (CRC), IL-1β has been documented to increase the expression of MIR301A in intestinal epithelial cells within colitis-associated cancer patients, which leads to downregulation of BTG anti-proliferation factor 1 (BTG1) expression [PMC8040557]. Lastly, FXR1 appears to protect MIR301A from degradation by PNPT1; without FXR1, PNPT1 can target and degrade MIR301A-3p [PMC6986764].
a aa a C ---U A - acu cugcu cg auGCU UGAC UUAUUGCACU CU gu u ||||| || ||||| |||| |||||||||| || || gacga gu uaCGA ACUG GAUAACGUGA ga cg u g aa c A UUAU C u aca
| Accession | MIMAT0000688 |
| Description | Homo sapiens hsa-miR-301a-3p mature miRNA |
| Sequence | 51 - CAGUGCAAUAGUAUUGUCAAAGC - 73 |
| Evidence |
experimental
cloned [2,4], Northern [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0022696 |
| Description | Homo sapiens hsa-miR-301a-5p mature miRNA |
| Sequence | 14 - GCUCUGACUUUAUUGCACUACU - 35 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
|