miRBase entry: hsa-mir-99b

Stem-loop hsa-mir-99b


Accession
MI0000746
Symbol
HGNC: MIR99B
Description
Homo sapiens hsa-mir-99b precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR99B is a microRNA that is part of the human transcriptional unit AY358799, located downstream of a cluster of three microRNAs (MIR99B, LET7E, miR125A) [PMC3783845]. Blocking the expression of MIR99B has been shown to restrict bacterial growth [PMC3576108]. MIR99B is highly expressed and an outlier in the distribution array [PMC7912193]. It targets several genes and is the second most expressed miRNA [PMC7912193]. MIR99B has been found in EVs and is associated with pancreatic cancer cells and AML cell-derived EXs [PMC9171400] [PMC7100658]. It has also been implicated in breast cancer metastases, endometrial cancer, and NASH [PMC5705145] [PMC6994408] [PMC9818030]. MIR99B has been shown to target IGF1R and participate in the shutdown of signal transduction pathways involving NF-κB pathways [PMC4290566]. It is part of a cluster with MIR125A and MIR7E on chromosome 19 [PMC3573016] and has been found to be upregulated in CF airway epithelial cell lines compared to non-CF controls [PMC7493015]. The functionality of MIR99B has been associated with carcinogenesis, as dysregulation of both mature miRNAs produced by MIR99B (hsa-miR-99b-3p and hsa-miR-99b-5p) have been linked to cancer development. Mutations within miRNAs can also be associated with cancer development. The role of MIR99B in macrophage activation regulation remains complex.

Literature search
137 open access papers mention hsa-mir-99b
(407 sentences)

Sequence

662095 reads, 1445 reads per million, 130 experiments
ggcaccCACCCGUAGAACCGACCUUGCGgggccuucgccgcacaCAAGCUCGUGUCUGUGGGUCCGuguc
(((((..(((((((((..(((.((((.(.(((....))).)...)))).)))..)))))))))..)))))

Structure
     cC         AC   C    --C g   c 
ggcac  ACCCGUAGA  CGA CUUG   G ggc u
|||||  |||||||||  ||| ||||   | |||  
cuguG  UGGGUGUCU  GCU GAAC   c ccg u
     CC         GU   C    aca g   c 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence is the predicted human homologue of mouse miR-99b, cloned from mouse brain [1] and embryonic stem cells [2,3]. Its expression was later validated in human [4-6].

Genome context
chr19: 51692612-51692681 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-99b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-99b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-99b-5p

Accession MIMAT0000689
Description Homo sapiens hsa-miR-99b-5p mature miRNA
Sequence 7 - CACCCGUAGAACCGACCUUGCG - 28
Evidence experimental
cloned [4-6]
Database links
Predicted targets

Mature hsa-miR-99b-3p

Accession MIMAT0004678
Description Homo sapiens hsa-miR-99b-3p mature miRNA
Sequence 45 - CAAGCUCGUGUCUGUGGGUCCG - 66
Evidence experimental
cloned [5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854

  4. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  5. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73