miRBase entry: cel-mir-354

Stem-loop cel-mir-354


Accession
MI0000753
Description
Caenorhabditis elegans cel-mir-354 precursor miRNA mir-354
Gene
family?
RF00799; mir-354

Literature search
2 open access papers mention cel-mir-354
(2 sentences)

Sequence

212 reads, 2 reads per million, 8 experiments
cagagccgacuaagcaccuuGGUGCGGCUGCAGACGGGUAUccggcucgacguucauacaucacgacuucuuuccuuuuACCUUGUUUGUUGCUGCUCCUauugguuuug
(((((((((...........((.(((((.(((((((((((...((...((.(((..........))).))...))...)))).))))))).))))).))..)))))))))

Structure
         cuaagcaccuu  U     U       -    Ucc  cuc  c   caua 
cagagccga           GG GCGGC GCAGACG GGUA   gg   ga guu    c
|||||||||           || ||||| ||||||| ||||   ||   || |||     
guuuugguu           CC CGUCG UGUUUGU CCAu   cc   cu cag    a
         ---------aU  U     U       U    uuu  uuu  u   cacu 


Annotation confidence Low
Do you think this miRNA is real?
Comments
This miRNA was predicted by computational analysis of C. elegans and C. briggsae, and expression of the mature microRNA confirmed by PCR amplification, cloning and sequencing. The 5' end of the mature sequence ws mapped by PCR, but the 3' ends have not been experimentally determined.

Genome context
chrI: 14468382-14468491 [-]

Database links

Mature cel-miR-354-3p

Accession MIMAT0000696
Description Caenorhabditis elegans cel-miR-354-3p mature miRNA
Sequence 80 - ACCUUGUUUGUUGCUGCUCCU - 100
Evidence experimental
cloned [1], PCR [1]

Mature cel-miR-354-5p

Accession MIMAT0031894
Description Caenorhabditis elegans cel-miR-354-5p mature miRNA
Sequence 21 - GGUGCGGCUGCAGACGGGUAU - 41
Evidence not_experimental
Database links

References

  1. PubMed ID: 15317971
    Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification
    "Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB"
    "RNA (2004) 10:1309-1322