miRBase entry: hsa-mir-361

Stem-loop hsa-mir-361


Accession
MI0000760
Symbol
HGNC: MIR361
Description
Homo sapiens hsa-mir-361 precursor miRNA mir-361
Gene
family?
RF00744; mir-361

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR361 is a gene encoding a microRNA located on the X chromosome, specifically in an intron between exons 9 and 10 of the CHM gene, and it produces two mature miRNA species, miR-361-3p and the more predominant miR-361-5p [PMC3498195]. The transcription of MIR361 is negatively regulated by SMAD4, which binds to the MIR361 promoter and functions as a trans-acting element to adjust VEGFA expression by negatively regulating MIR361 transcription [PMC7563248]. This regulatory relationship was further confirmed through luciferase reporter assays which demonstrated SMAD4's inhibitory effect on MIR361 promoter activity [PMC7563248]. Additionally, MIR361 expression is influenced by the TGF-β signaling pathway [PMC7563248], and it has been identified as differentially expressed in various physiological states such as pregnancy, where it was found to be upregulated in women during the first and third trimesters [PMC9700700]. Moreover, MIR361 has been implicated as a tumor suppressor in endometrial cancers when downregulated [PMC8369952], suggesting its potential role in tumorigenesis. In cardiovascular contexts, increased serum levels of MIR361 have been associated with heart failure (HF) and major adverse cardiac events (MACE) [PMC9967129].

Literature search
63 open access papers mention hsa-mir-361
(430 sentences)

Sequence

85647 reads, 367 reads per million, 146 experiments
ggagcUUAUCAGAAUCUCCAGGGGUACuuuauaauuucaaaaagUCCCCCAGGUGUGAUUCUGAUUUgcuuc
(((((..(((((((((.((.((((.(((((..........))))).)))).))...)))))))))..)))))

Structure
     UU         --U  A    U     auaa 
ggagc  AUCAGAAUC   CC GGGG ACuuu    u
|||||  |||||||||   || |||| |||||     
cuucg  UAGUCUUAG   GG CCCC Ugaaa    u
     UU         UGU  A    C     aacu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 85903636-85903707 [-]

Disease association
hsa-mir-361 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-361-5p

Accession MIMAT0000703
Description Homo sapiens hsa-miR-361-5p mature miRNA
Sequence 6 - UUAUCAGAAUCUCCAGGGGUAC - 27
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-361-3p

Accession MIMAT0004682
Description Homo sapiens hsa-miR-361-3p mature miRNA
Sequence 45 - UCCCCCAGGUGUGAUUCUGAUUU - 67
Evidence experimental
cloned [2-3], Northern [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 18230126
    New miRNAs cloned from neuroblastoma
    "Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F"
    "BMC Genomics (2008) 9:52

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230