MIR361 is a gene encoding a microRNA located on the X chromosome, specifically in an intron between exons 9 and 10 of the CHM gene, and it produces two mature miRNA species, miR-361-3p and the more predominant miR-361-5p [PMC3498195]. The transcription of MIR361 is negatively regulated by SMAD4, which binds to the MIR361 promoter and functions as a trans-acting element to adjust VEGFA expression by negatively regulating MIR361 transcription [PMC7563248]. This regulatory relationship was further confirmed through luciferase reporter assays which demonstrated SMAD4's inhibitory effect on MIR361 promoter activity [PMC7563248]. Additionally, MIR361 expression is influenced by the TGF-β signaling pathway [PMC7563248], and it has been identified as differentially expressed in various physiological states such as pregnancy, where it was found to be upregulated in women during the first and third trimesters [PMC9700700]. Moreover, MIR361 has been implicated as a tumor suppressor in endometrial cancers when downregulated [PMC8369952], suggesting its potential role in tumorigenesis. In cardiovascular contexts, increased serum levels of MIR361 have been associated with heart failure (HF) and major adverse cardiac events (MACE) [PMC9967129].
UU --U A U auaa ggagc AUCAGAAUC CC GGGG ACuuu u ||||| ||||||||| || |||| ||||| cuucg UAGUCUUAG GG CCCC Ugaaa u UU UGU A C aacu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000703 |
Description | Homo sapiens hsa-miR-361-5p mature miRNA |
Sequence | 6 - UUAUCAGAAUCUCCAGGGGUAC - 27 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004682 |
Description | Homo sapiens hsa-miR-361-3p mature miRNA |
Sequence | 45 - UCCCCCAGGUGUGAUUCUGAUUU - 67 |
Evidence |
experimental
cloned [2-3], Northern [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|