miRBase entry: hsa-mir-361

Stem-loop hsa-mir-361


Accession
MI0000760
Symbol
HGNC: MIR361
Description
Homo sapiens hsa-mir-361 precursor miRNA mir-361
Gene
family?
RF00744; mir-361

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR361 is a microRNA that is encoded on the × chromosome and gives rise to two mature miRNA species, miRNA-361-3p and miRNA-361-5p [PMC3498195]. Previous studies have shown that MIR361 is involved in the regulation of gene expression [PMC3526356]. It has been found that MIR361 can bind to the 3'-UTR of AID and repress its expression [PMC3526356]. In Burkitt lymphoma cell lines, the responsiveness of several candidates to miR-155 and/or MIR361 was tested [PMC3526356]. SMAD4 has been identified as a negative regulator of MIR361 transcription, and its overexpression or knockdown affects the expression of MIR361 [PMC7563248]. The transcriptional regulation of MIR361 by SMAD4 has been shown to adjust VEGFA expression [PMC7563248]. In addition, MIR361 has been found to be differentially expressed in different stages of pregnancy and in women with gestational diabetes mellitus (GDM) [PMC9700700] [PMC8369952] [PMC9700700]. It has also been implicated as a tumor suppressor in endometrial cancers when downregulated, while its silencing is associated with hepatocellular carcinoma (HCC), gastric cancer (GC), and colorectal cancer (CRC) [PMC8369952] [PMC5496572]  The level of MIR361 has been found to be associated with the level of miR-146a in certain conditions such as heart failure (HF) and major adverse cardiovascular events (MACE) [ PMC9433550]  Overall, these studies highlight the importance of MIR361 in various biological processes such as gene regulation, pregnancy, diabetes mellitus, and cancer.

Literature search
63 open access papers mention hsa-mir-361
(430 sentences)

Sequence

85647 reads, 697 reads per million, 146 experiments
ggagcUUAUCAGAAUCUCCAGGGGUACuuuauaauuucaaaaagUCCCCCAGGUGUGAUUCUGAUUUgcuuc
(((((..(((((((((.((.((((.(((((..........))))).)))).))...)))))))))..)))))

Structure
     UU         --U  A    U     auaa 
ggagc  AUCAGAAUC   CC GGGG ACuuu    u
|||||  |||||||||   || |||| |||||     
cuucg  UAGUCUUAG   GG CCCC Ugaaa    u
     UU         UGU  A    C     aacu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 85903636-85903707 [-]

Disease association
hsa-mir-361 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-361-5p

Accession MIMAT0000703
Description Homo sapiens hsa-miR-361-5p mature miRNA
Sequence 6 - UUAUCAGAAUCUCCAGGGGUAC - 27
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-361-3p

Accession MIMAT0004682
Description Homo sapiens hsa-miR-361-3p mature miRNA
Sequence 45 - UCCCCCAGGUGUGAUUCUGAUUU - 67
Evidence experimental
cloned [2-3], Northern [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 18230126
    New miRNAs cloned from neuroblastoma
    "Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F"
    "BMC Genomics (2008) 9:52

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230