MIR361 is a microRNA that is encoded on the × chromosome and gives rise to two mature miRNA species, miRNA-361-3p and miRNA-361-5p [PMC3498195]. Previous studies have shown that MIR361 is involved in the regulation of gene expression [PMC3526356]. It has been found that MIR361 can bind to the 3'-UTR of AID and repress its expression [PMC3526356]. In Burkitt lymphoma cell lines, the responsiveness of several candidates to miR-155 and/or MIR361 was tested [PMC3526356]. SMAD4 has been identified as a negative regulator of MIR361 transcription, and its overexpression or knockdown affects the expression of MIR361 [PMC7563248]. The transcriptional regulation of MIR361 by SMAD4 has been shown to adjust VEGFA expression [PMC7563248]. In addition, MIR361 has been found to be differentially expressed in different stages of pregnancy and in women with gestational diabetes mellitus (GDM) [PMC9700700] [PMC8369952] [PMC9700700]. It has also been implicated as a tumor suppressor in endometrial cancers when downregulated, while its silencing is associated with hepatocellular carcinoma (HCC), gastric cancer (GC), and colorectal cancer (CRC) [PMC8369952] [PMC5496572] The level of MIR361 has been found to be associated with the level of miR-146a in certain conditions such as heart failure (HF) and major adverse cardiovascular events (MACE) [ PMC9433550] Overall, these studies highlight the importance of MIR361 in various biological processes such as gene regulation, pregnancy, diabetes mellitus, and cancer.
UU --U A U auaa ggagc AUCAGAAUC CC GGGG ACuuu u ||||| ||||||||| || |||| ||||| cuucg UAGUCUUAG GG CCCC Ugaaa u UU UGU A C aacu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000703 |
Description | Homo sapiens hsa-miR-361-5p mature miRNA |
Sequence | 6 - UUAUCAGAAUCUCCAGGGGUAC - 27 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0004682 |
Description | Homo sapiens hsa-miR-361-3p mature miRNA |
Sequence | 45 - UCCCCCAGGUGUGAUUCUGAUUU - 67 |
Evidence |
experimental
cloned [2-3], Northern [3] |
Database links | |
Predicted targets |
|