MIR365B is a microRNA gene located within the NF1 microdeletion region, which is associated with neurofibromatosis type 1 (NF1) and tumorigenesis [PMC5370280]. Patients with NF1 microdeletions are hemizygous for MIR365B, along with other genes such as NF1, SUZ12, ATAD5, and MIR193A [PMC5370280]. The loss of MIR193A and MIR365B genes in patients with NF1 microdeletions may contribute to tumorigenesis in these individuals [PMC5370280]. While the role of SUZ12 loss in malignant peripheral nerve sheath tumor (MPNST) progression is well-documented, less is known about the involvement of ATAD5, MIR193A, and MIR365B in MPNST pathogenesis [PMC5370280]. The 1.4-Mb NF1 microdeletion region contains four microRNA genes: MIR193A, MIR365B, MIR4725, and MIR4733 [PMC5370280]. RT-qPCR analysis has been performed to study gene expression using TaqMan assays for validation purposes [PMC8278229]. Several miRNAs including miR-4262, miR-506-3p, and MIR365B have been identified as tumor suppressors targeting GALNT4 [PMC8504460]. Drosha cleavage activity has been detected over intronic regions of genes such as CTDSP1 and long noncoding RNA (lncRNA)-derived genes like MIR193A and MIR365B using POINT-5 analysis [PMC8122139]. ATAD5 along with other genes like miR193A and miR365B have been identified as having tumor suppressor activity within the NF1 microdeletion region [PMC8395254].
agaguguucaa g -- a AC C ----- U u g aca gcaagaa aaugAGGG UUU AGGGGCA GCUG guu u | ||| ||||||| |||||||| ||| ||||||| |||| ||| c ugu cguucuu uUAUUCCU AAA UCCCCGU ugac cag c -----gggcua g ga g -A A AAUac u u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0022833 |
Description | Homo sapiens hsa-miR-365b-5p mature miRNA |
Sequence | 29 - AGGGACUUUCAGGGGCAGCUGU - 50 |
Evidence |
experimental
454 [5] |
Database links | |
Predicted targets |
Accession | MIMAT0022834 |
Description | Homo sapiens hsa-miR-365b-3p mature miRNA |
Sequence | 68 - UAAUGCCCCUAAAAAUCCUUAU - 89 |
Evidence |
experimental
cloned [1,3-4], array-cloned [2] |
Database links | |
Predicted targets |
|