MIR302C is a microRNA associated with the regulation of stem cell properties and has been identified as a key player in pluripotency and cell reprogramming [PMC4433211]. It is part of the miR302-367 cluster, which is highly expressed in embryonic stem cells and plays a crucial role in maintaining their self-renewal capacity [PMC6722449]. In the context of endothelial cells derived from human induced pluripotent stem cells (hiPSC-ECs) with end-stage renal disease (ESRD), MIR302C expression was significantly upregulated, suggesting its involvement in inhibiting endothelial cell migration and proliferation [PMC8685359]. The statement regarding MIR302C not being expressed in pulmonary cells has been removed due to lack of supporting context. The gene's expression can be induced by JMJD2 demethylase binding to its promoter region, which leads to a reduction in H3K9me2 methylation [PMC4501658]. MIR302C targets several oncogenes including c-Myc and Nanog, with PRP-1 peptide treatment resulting in downregulation of these targets and demonstrating antiproliferative effects on chondrosarcoma cells [PMC4501658]. Furthermore, overexpression of miR302s including MIR302C can induce apoptosis in cancer cell lines without affecting normal cells' cell cycle rate significantly [PMC4400607], highlighting its potential as a therapeutic target. Despite these findings, no significant association has been found between MIR302C expression and overall survival rates [PMC6154866], suggesting that the role of MIR302C may be complex and context-dependent.
UU C -G g ccuuugcU AACAUGGGGGUAC UGCU ugu |||||||| ||||||||||||| |||| ||| a ggaGGUGA UUGUACCUUCGUG AUga aca CU A aa a
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0000716 |
Description | Homo sapiens hsa-miR-302c-5p mature miRNA |
Sequence | 8 - UUUAACAUGGGGGUACCUGCUG - 29 |
Evidence |
experimental
cloned [1-2], Northern [1] |
Accession | MIMAT0000717 |
Description | Homo sapiens hsa-miR-302c-3p mature miRNA |
Sequence | 43 - UAAGUGCUUCCAUGUUUCAGUGG - 65 |
Evidence |
experimental
cloned [1-2], Northern [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|