WARNING: This summary was generated by AI. MIR302D is a gene encoding the miR-302d-3p microRNA, a member of the highly conserved miR-302 family, which is known to play a role in the self-renewal of human embryonic stem cells and is involved in the regulation of the cell cycle [PMC5906557][PMC4218680'>PMC5906557][PMC4218680[PMC4218680]. This microRNA family, including MIR302D, is predominantly expressed in pluripotent stem cells and multipotent progenitor cells [PMC5966391]. In a study focusing on extracellular vesicles from morphine-treated organoids, MIR302D levels were found to be increased [PMC8225561]. The study also identified c-Jun as an upstream transcription factor potentially regulating MIR302D expression and implicated this regulation as an alternative explanation for JNK pathway involvement in AMD pathogenesis [PMC5906557]. The regulatory role of c-Jun on MIR302D expression was further illustrated using pharmacological modulators of the JNK pathway [PMC5906557]. Additionally, MIR302D was shown to potentially regulate IL-25 expression and was involved in inhibiting CCL5 expression under hypoxic conditions, which suggests its role in inflammatory responses [PMC8225561][PMC4454318[PMC4454318]. However, the statement regarding MIR302D's association with inhibition of endothelial cell migration and proliferation in human induced pluripotent stem cell-derived endothelial cells from end-stage renal disease patients is not supported by the provided reference [PMC8685359], and therefore, this part of the summary should be disregarded.
uc U ---C ga cc uACUU AACAUGGAGGCACUUG ugu c || ||||| |||||||||||||||| ||| gg GUGAG UUGUACCUUCGUGAAU aca a -U U aaaa gu
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0004685 |
| Description | Homo sapiens hsa-miR-302d-5p mature miRNA |
| Sequence | 6 - ACUUUAACAUGGAGGCACUUGC - 27 |
| Evidence |
experimental
cloned [2] |
| Accession | MIMAT0000718 |
| Description | Homo sapiens hsa-miR-302d-3p mature miRNA |
| Sequence | 44 - UAAGUGCUUCCAUGUUUGAGUGU - 66 |
| Evidence |
experimental
cloned [1-2], Northern [1] |
| Database links |
|
| Predicted targets |
|
|