MIR302D is a member of the miR-302 family, which includes mature miRNAs encoded by genes MIR302A, MIR302B, MIR302C, and MIR302D [PMC5906557]. In morphine-treated organoids, the levels of miR186, miR181a, and MIR302D were increased [PMC8225561]. Let7c-5p potentially targets IL-6 and TLR4; IL-1α is a predicted target of miR181a and miR410; several microRNAs including MIR302D potentially regulate the expression of IL-25 [PMC8225561]. c-Jun is identified as a potential upstream transcript factor for MIR302D [PMC5906557]. The regulatory role of c-Jun on MIR302D expression is implied in the study [PMC5906557]. MiR-302d-3p is the mature miRNA encoded by the MIR302D gene located on 4q25 [PMC5906557]. The study used SP600125 and anisomycin to suppress or promote the JNK pathway and c-Jun activation to investigate their effect on MIR302D expression [PMC5906557]. MIR302D is highly expressed in both pluripotent stem cells and multipotent progenitor cells [PMC5966391]. MIR302D is one of the upregulated genes associated with the inhibition of endothelial cell migration and proliferation in ESRD-hiPSC-ECs [PMC8685359].
uc U ---C ga cc uACUU AACAUGGAGGCACUUG ugu c || ||||| |||||||||||||||| ||| gg GUGAG UUGUACCUUCGUGAAU aca a -U U aaaa gu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0004685 |
Description | Homo sapiens hsa-miR-302d-5p mature miRNA |
Sequence | 6 - ACUUUAACAUGGAGGCACUUGC - 27 |
Evidence |
experimental
cloned [2] |
Accession | MIMAT0000718 |
Description | Homo sapiens hsa-miR-302d-3p mature miRNA |
Sequence | 44 - UAAGUGCUUCCAUGUUUGAGUGU - 66 |
Evidence |
experimental
cloned [1-2], Northern [1] |
Database links | |
Predicted targets |
|