MIR380 is a microRNA implicated in the regulation of p53 signaling, particularly noted for its role in neuroblastoma where it attenuates this tumor suppressor pathway [PMC8044846]. In the context of multiple myeloma (MM), MIR380, along with miR382, is upregulated in mesenchymal stem cells (MSCs) by HDAC3, which also stimulates the expression of TSG101, a component of the ESCRT complex [PMC8044846]. This upregulation contributes to an increase in MSC-exosome content of MIR380 [PMC8044846]. However, when HDAC3 is knocked down, there is a notable decrease in exosomal expression of MIR380 and other miRNAs associated with pro-survival functions [PMC6883144], leading to cell growth arrest [PMC8392438]. This suggests that MIR380 may play a role in tumor survival and proliferation. Additionally, it has been observed that exosomes from MM cells co-cultured with MSCs exhibit increased levels of pro-survival miRNAs including MIR380 when compared to MM cells alone [PMC6883144], indicating an interaction between MSCs and MM cells that may affect tumor progression.
GUU GA C c aagaUG GACCAUA ACAUGCG uau u |||||| ||||||| ||||||| ||| UUCUAC CUGGUAU UGUAUgc gug c -AC AA u u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000734 |
Description | Homo sapiens hsa-miR-380-5p mature miRNA |
Sequence | 5 - UGGUUGACCAUAGAACAUGCGC - 26 |
Evidence | not_experimental |
Accession | MIMAT0000735 |
Description | Homo sapiens hsa-miR-380-3p mature miRNA |
Sequence | 40 - UAUGUAAUAUGGUCCACAUCUU - 61 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|