MIR380 is a microRNA that has been shown to attenuate p53 signaling in neuroblastoma and is transcribed from the maternal chromosome along the Rian extension of the Dlk1-Dio3 imprinted domain [PMC8044846] [PMC3919614]. Inhibitory experiments have demonstrated that HDAC3 plays a regulatory role in mesenchymal stem cells (MSCs) by stimulating the expression of Tumor Susceptibility Gene 101 (TSG101) and increasing the content of MIR380 and miR382 in MSC-derived exosomes [PMC8044846]. miR382 is overexpressed in multiple myeloma (MM) patients and targets tumor suppressor genes involved in tumor proliferation and survival, suggesting a pathogenetic function for this microRNA [PMC8044846] [PMC6883144]. Knockdown of HDAC3 leads to a decrease in exosomal expression of MIR380, miR382, as well as other pro-survival microRNAs such as miR15b, miR9986, and miR5191, resulting in cell growth arrest [PMC8392438] [PMC6883144]. Co-culturing MM cells with HDAC3-expressing cells leads to increased expression of pro-survival microRNAs including MIR380 and miR382 in exosomes derived from MM cells [PMC6883144]. These findings suggest that MIR380 and miR382 may have important roles in regulating cell survival and proliferation, particularly in the context of neuroblastoma and MM.
GUU GA C c aagaUG GACCAUA ACAUGCG uau u |||||| ||||||| ||||||| ||| UUCUAC CUGGUAU UGUAUgc gug c -AC AA u u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000734 |
Description | Homo sapiens hsa-miR-380-5p mature miRNA |
Sequence | 5 - UGGUUGACCAUAGAACAUGCGC - 26 |
Evidence | not_experimental |
Accession | MIMAT0000735 |
Description | Homo sapiens hsa-miR-380-3p mature miRNA |
Sequence | 40 - UAUGUAAUAUGGUCCACAUCUU - 61 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
|