Stem-loop hsa-mir-340

Accession

MI0000802

Symbol

HGNC: MIR340

Description

Homo sapiens hsa-mir-340 precursor miRNA mir-340

Gene
family

RF00761; mir-340

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR340 is a host microRNA that has been identified as a potential therapeutic target against influenza virus infection [PMC6370596]. Studies have shown that miR144-deficient mice, which have decreased immunosuppression, exhibit increased resistance to influenza virus [14]. This suggests that targeting host miRNAs, such as MIR340, could be an effective strategy for combating influenza virus infection [PMC6370596]. In fact, experimental miRNA-dependent strategies have been developed against hepatitis C and influenza A viruses [41, 42]. In the present study, the antiviral factors RIG-I and OAS2 were identified as targets of MIR340 [PMC6370596]. Specifically, MIR340 target sites were found in the 3ʹ UTR of RIG-I at positions 1,657 and 1,809 [PMC6370596]. This supports the concept that targeting host miRNAs like MIR340 could be a novel therapeutic approach against influenza virus infection due to the pleiotropic function of miRNAs in the virus-host interplay [PMC6370596]. Additionally, stimulating immunity via RIG-I has been shown to be an effective strategy against influenza A virus infection [39, 40]. Overall, these findings highlight the potential of targeting MIR340 and other host miRNAs as therapeutic approaches for combating influenza virus infection.

Literature search

75 open access papers mention hsa-mir-340
(422 sentences)

Sequence

271302 reads, 1711 reads per million, 133 experiments

uuguaccuggugugaUUAUAAAGCAAUGAGACUGAUUgucauaugucguuugugggaUCCGUCUCAGUUACUUUAUAGCcauaccugguaucuua
..(((((.((((((.((((((((...((((((.((((.(((((.......))))))))).))))))....)))))))).)))))).)))))....

Structure

--uu     u      a        -CAA      U    g     ug 
    guacc ggugug UUAUAAAG    UGAGAC GAUU ucaua  u
    ||||| |||||| ||||||||    |||||| |||| |||||  c
    uaugg ccauac GAUAUUUC    ACUCUG CUag ggugu  g
auuc     u      C        AUUG      C    -     uu 

Annotation confidence High

Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Landgraf et al. show that the 5' product is the predominant one in human, mouse and rat [3], in contrast to the previous annotation. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

chr5: 180015303-180015397 [-]

Disease association

hsa-mir-340 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-340-5p

• Accession: MIMAT0004692
• Description: Homo sapiens hsa-miR-340-5p mature miRNA
• Sequence: 16 - UUAUAAAGCAAUGAGACUGAUU - 37
• Evidence: experimental ; cloned [3]

Mature hsa-miR-340-3p

• Accession: MIMAT0000750
• Description: Homo sapiens hsa-miR-340-3p mature miRNA
• Sequence: 58 - UCCGUCUCAGUUACUUUAUAGC - 79
• Evidence: experimental ; cloned [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73


3. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365