MIR340 is a host microRNA that has been identified as a potential therapeutic target against influenza virus infection [PMC6370596]. Studies have shown that miR144-deficient mice, which have decreased immunosuppression, exhibit increased resistance to influenza virus [14]. This suggests that targeting host miRNAs, such as MIR340, could be an effective strategy for combating influenza virus infection [PMC6370596]. In fact, experimental miRNA-dependent strategies have been developed against hepatitis C and influenza A viruses [41, 42]. In the present study, the antiviral factors RIG-I and OAS2 were identified as targets of MIR340 [PMC6370596]. Specifically, MIR340 target sites were found in the 3สน UTR of RIG-I at positions 1,657 and 1,809 [PMC6370596]. This supports the concept that targeting host miRNAs like MIR340 could be a novel therapeutic approach against influenza virus infection due to the pleiotropic function of miRNAs in the virus-host interplay [PMC6370596]. Additionally, stimulating immunity via RIG-I has been shown to be an effective strategy against influenza A virus infection [39, 40]. Overall, these findings highlight the potential of targeting MIR340 and other host miRNAs as therapeutic approaches for combating influenza virus infection.
--uu u a -CAA U g ug guacc ggugug UUAUAAAG UGAGAC GAUU ucaua u ||||| |||||| |||||||| |||||| |||| ||||| c uaugg ccauac GAUAUUUC ACUCUG CUag ggugu g auuc u C AUUG C - uu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004692 |
Description | Homo sapiens hsa-miR-340-5p mature miRNA |
Sequence | 16 - UUAUAAAGCAAUGAGACUGAUU - 37 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000750 |
Description | Homo sapiens hsa-miR-340-3p mature miRNA |
Sequence | 58 - UCCGUCUCAGUUACUUUAUAGC - 79 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|